• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of nihpaAbout Author manuscriptsSubmit a manuscriptNIH Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
J Biol Chem. Author manuscript; available in PMC Jun 30, 2006.
Published in final edited form as:
PMCID: PMC1483932
NIHMSID: NIHMS10783

ADAMTS-12 Associates with and Degrades Cartilage Oligomeric Matrix Protein*

Abstract

Loss of articular cartilage because of extracellular matrix breakdown is the hallmark of arthritis. Degradative fragments of cartilage oligomeric matrix protein (COMP), a prominent noncollagenous matrix component in articular cartilage, have been observed in the cartilage, synovial fluid, and serum of arthritis patients. The molecular mechanism of COMP degradation and the enzyme(s) responsible for it, however, remain largely unknown. ADAMTS-12 (a disintegrin and metalloprotease with thrombospondin motifs) was shown to associate with COMP both in vitro and in vivo. ADAMTS-12 selectively binds to only the epidermal growth factor-like repeat domain of COMP of the four functional domains tested. The four C-terminal TSP-1-like repeats of ADAMTS-12 are shown to be necessary and sufficient for its interaction with COMP. Recombinant ADAMTS-12 is capable of digesting COMP in vitro. The COMP-degrading activity of ADAMTS-12 requires the presence of Zn2+ and appropriate pH (7.5-9.5), and the level of ADAMTS-12 in the cartilage and synovium of patients with both osteoarthritis and rheumatoid arthritis is significantly higher than in normal cartilage and synovium. Together, these findings indicate that ADAMTS-12 is a new COMP-interacting and -degrading enzyme and thus may play an important role in the COMP degradation in the initiation and progression of arthritis.

More than 15% of the world population older than 18 years are affected by arthritic disorders, including osteoarthritis (OA)3 and rheumatoid arthritis (RA) (1). Accumulating evidence suggests that proteases perform an important function in the breakdown of the extracellular matrix in OA and RA (2). Cartilage oligomeric matrix protein (COMP), a prominent noncollagenous component of cartilage, accounts for ~1% of the wet weight of articular tissue (3, 4). COMP is a 524-kDa pentameric, disulfide-bonded, multidomain glycoprotein composed of approximately equal subunits (~110 kDa each) (5, 6). Several studies suggest that monitoring of COMP levels (in both joint fluid and serum) can be used to assess the presence and progression of arthritis (7-11). Synovial fluid COMP levels were found to be higher in individuals with knee pain or injury (12), anterior cruciate ligament or meniscal injury (9, 12), OA (8, 12), and RA (7, 13) than in healthy individuals.

Fragments of COMP have been detected in the cartilage, synovial fluid, and serum of patients with post-traumatic and primary OA and RA (7, 8, 13). The molecular mechanism of COMP degradation and the enzyme (s) responsible for it, however, remain largely unknown. Theoretically, inhibition of degradative enzymes can slow down or block the initiation and progression of arthritic diseases. The isolation of cartilage degradative enzymes is therefore of great interest from both a pathophysiological and a therapeutic standpoint. The ADAMTS family (ADAMTS: (a disintegrin and metalloprotease with thrombospondin motifs) consists of secreted zinc metalloproteinases with a precisely ordered modular organization that includes at least one thrombospondin type I repeat (14, 15). Important functions have been established for several members of the ADAMTS family. ADAMTS-1, ADAMTS-4, ADAMTS-5, and ADAMTS-8 degrade the cartilage proteoglycan aggrecan and play a major role in aggrecan loss in arthritis (16-21). ADAMTS-5 was shown to be the major aggrecanase in mouse cartilage in vivo (22, 23). ADAMTS-1 and ADAMTS-4 also participate in the turnover of the proteoglycans versican and brevican in blood vessels (24) and the nervous system, respectively (25). ADAMTS-2, ADAMTS-3, and ADAMTS-14 are procollagen N-propeptidases (26, 27). ADAMTS-2 mutations cause dermatosparaxis, an inherited disorder characterized by severe skin fragility (28). ADAMTS-13 is a von Willebrand factor-cleaving protease, and its mutations lead to heritable life threatening thrombocytopenic purpura (29-33). Several other ADAMTS enzymes whose functions are presently unknown, including ADAMTS-12, have been discovered through molecular cloning and classified as orphan ADAMTS. Expression profile analysis of the ADAMTS family in cartilage revealed that ADAMTS-12 is significantly higher in OA patients than in normal controls (1), indicating that ADAMTS-12 is probably an important enzyme that causes cartilage degradation in arthritic disorders.

In this study, we report the identification of ADAMTS-12 as a novel metalloproteinase known to bind to (through specific molecular domains for each binding partner) and degrade COMP. The relevance of this interaction is exemplified by the up-regulation of ADAMTS-12 mRNA in arthritic cartilage and synovium.

EXPERIMENTAL PROCEDURES

Plasmid Constructs—Yeast expression vectors pDBleu and pPC86 were obtained from Invitrogen. The segment encoding the four functional domains of mouse COMP: the N-terminal (amino acids 20-83), EGF repeat domain (amino acids 84-261), type III repeat domain (amino acids 266-520), and C-terminal domain (amino acids 521-755; GenBank™ accession number AF257516) were amplified by PCR and cloned in-frame into the SalI/NotI sites of pDBleu to generate pDB-COMP-NT, pDB-COMP-EGF, pDB-COMP-type III, and pDB-COMP-CT yeast expression constructs.

cDNA inserts encoding the following fragments of human ADAMTS-12 (See Fig. 4) were cloned in-frame into the SalI/NotI sites of pPC86 vector to generate the indicated plasmids: Fragment: Prodomain (amino acids 26-240), metalloproteinase domains (amino acids 241-463), disintegrin-like and cysteine-rich domain (amino acids 464-701), spacer-1 plus three middle TSP repeats (amino acids 702-995), spacer-2 plus C-terminal 4 TSP repeats plus C-terminal unique region (amino acids 996-1593), four C-terminal TSP repeats plus C-terminal unique region (amino acids 1316-1593), C-terminal unique region (amino acids 1531-1593), and four C-terminal TSP repeats (amino acids 1316-1530). Plasmid: pADAMTS-12 (26-240), pADAMTS-12-(241-463), pADAMTS-12-(464-701), pADAMTS-12-(702-995), pADAMTS-12-(996-1593), pADAMTS-12-(1316-1593), pADAMTS-12-(1531-1593), and pADA-MTS-12-(1316-1530).

FIGURE 4
Four C-terminal TSP motifs of ADAMTS-12 are necessary and sufficient for interaction with COMP. A, schematic diagram of ADAMTS-12 constructs used to map those of its fragments that bind to COMP. Numbers refer to amino acid residues in ADAMTS-12; ovals ...

The bacterial expression vector pGEX-3X (Invitrogen) was used to produce recombinant GST fusion proteins in Escherichia coli. The cDNA fragments encoding the catalytic domain of hADAMTS-12 (amino acids 241-463, GenBank™ accession number AJ250725) and the EGF-like domain of COMP (amino acids 84-261) were inserted in-frame into the BamHI/EcoRI sites of pGEX-3X to generate the pGEX12-CD and pGEX-COMP-EGF plasmids. The bacterial expression pBAD TOPO vector (Invitrogen) was used to produce His-tagged proteins in E. coli. A cDNA segment encoding the four C-terminal TSP motifs (His-TS12C4TSP) of hADAMTS-12 (amino acids 1316-1530) was subcloned into the pBAD TOPO vector per the manufacturer’s protocol. All constructs were verified by nucleic acid sequencing; subsequent analysis was performed using Curatools (Curagen, New Haven, CT) and BLAST software.

Expression and Purification of GST and His-tagged Proteins—For expression of GST fusion proteins, the pGEX12-CD and pGEX-COMP-EGF plasmids were transformed into E. coli DH5α (Invitrogen). Fusion proteins were affinity-purified on glutathione-agarose beads as previously described (34). To cleave off and remove the GST moiety from the GST fused catalytic domain of ADAMTS-12, 50 μg of purified GST-TS12-CD fusion protein was incubated with 1 μg of Xa factor (New England Biolabs, Beverly, MA) in 20 μl of 20mm Tris-HCl (pH 8.0), 100 mm NaCl, 2 mm CaCl2 at 23 °C for 8 h. The reaction was terminated by the addition of 2 μm dansyl-Glu-Gly-Arg-chloromethyl ketone (New England Biolabs) and incubated at room temperature for 1 min. The completion of the cleavage was established by SDS-PAGE and the resultant GST moiety was removed using glutathione-Sepharose-4B beads (Amersham Biosciences).

His-TS12C4TSP was purified by affinity chromatography using a HiTrap chelating column (Amersham Biosciences). Briefly, bacteria lysates supplemented with 20 mm HEPES, pH 7.5 and 0.5 m NaCl were applied to the HiTrap chelating column, the column was washed with HSB buffer (40 mm HEPES, pH 7.5, 1 m NaCl, 0.05% Brij 35) containing 10 mm imidazole, and the His-TS7C4TSP was eluted with HSB buffer containing 300 mm imidazole.

Assay of Protein-Protein Interactions using the Yeast Two-hybrid System—Three independent colonies were analyzed for interaction in yeast of two proteins, one of which was fused to the Gal4 DNA binding domain and the other to the VP16 transactivation domain. The procedures of Vojtek et al. (35) and Hollenberg et al. (36) were followed for (a) growing and transforming the yeast strain MAV203 with the selected plasmids; and (b) testing β-galactosidase activity and growth phenotypes on (S.D.-leu-/trp-/his-/ura-/3AT+) plates and on plates containing 5-fluoroorotic acid (S.D.-leu-/trp-/5FOA+).

In Vitro GST Pulldown Assay—To determine whether COMP binds to ADAMTS-12 in vitro, glutathione-Sepharose beads (50 μl) preincubated with either purified GST (0.5 μg; serving as control) or GST-COMP-EGF (0.5 μg) were incubated with 500 μg of cell lysates prepared from COS-7 cells transfected with an expression plasmid either wild-type ADAMTS-12 (pcDNA3-ADAMTS12-HA) or ADAMTS-12 with mutant catalytic domain (pcDNA3-ADAMTS12-MUT, provided by Drs. Cal and Lopez-Otin) (39) in 150 μl of buffer AM (10 mm Tris-HCl, pH. 7.9, 10% glycerol, 100 mm KCl, and 0.5 mg/ml bovine serum albumin). The bound proteins were denatured in sample buffer, resolved by 10% SDS-PAGE, and detected by Western blotting with anti-HA antibody (Santa Cruz Biotechnology, Santa Cruz, CA).

Solid Phase Binding Assay—Microtiter plates (96-well EIA/RIA plates, Costar, Badhoevedorp, The Netherlands) were coated with various amounts (0.001-5.000 μg) of purified His-TS12C4TSP in 100 μl of TBS buffer (50 mm Tris-HCl, 150 mm NaCl, pH 7.4) overnight at 4 °C. Wells were blocked with 1% bovine serum albumin in TBS buffer for 3 h at 37 °C. After washing with TBS and 0.05% Tween, 100 μl of 50 μg/ml of COMP was added to each well, followed by the addition of 10 mm CaCl2 ; samples were then allowed to bind overnight at 4 °C. Bound protein from the liquid phase was detected by mouse monoclonal antibody against COMP, followed by a secondary antimouse antibody conjugated with horseradish peroxidase (Antigenix America, Huntington Station, NY) and 5-amino-2-hydroxybenzoic acid as a substrate, with absorbance measured at 492 nm in an ELISA reader.

Coimmunoprecipitation—COMP stable line was transfected with a mammalian expression construct pcDNA3-ADAMTS12-HA that encodes a HA-tagged ADAMTS-12 (generously provided by Drs. S. Cal and C. Lopez-Otin) (39). 48 h after transfection, the cultures and media were extracted with immunoprecipitation buffer (50 mm Tris-HCl, pH 7.4 containing the proteinase inhibitors 1 mm phenylmethylsulfonyl fluoride, 2 mm N-ethylmaleimide, and 0.025 mg/ml leupeptin). Approximately 500 μg of cell extract was incubated with anti-COMP (25 μg/ml), anti-HA (25 μg/ml, Santa Cruz Biotechnology) or control rabbit IgG (25 μg/ml) antibodies for 1 h, followed by incubation with 30 μl of protein A-agarose (Invitrogen) at 4 °C overnight. After washing five times with immunoprecipitation buffer, bound proteins were released by boiling in 20 μl of 2× SDS loading buffer for 3 min (40). Released proteins were examined by Western blotting with anti-COMP antibodies, and the signal detected using the ECL chemiluminescent system (Amersham Biosciences).

In Vitro Digestion Assay—To determine whether ADAMTS-12 can digest COMP in vitro, a cotransfection assay was performed. Briefly, a COMP stable line was transfected with either control or expression constructs encoding wild-type ADAMTS-12 (pcDNA3-ADAMTS12-HA-FLAG) or ADAMTS-12 with mutant catalytic domain (pcDNA3-ADAMTS12-MUT) (39). Seventy-two hours after transfection, the media were collected and subjected to 8% nonreduced SDS-PAGE and intact COMP, and fragments were detected by Western blotting with polyclonal rabbit anti-COMP antiserum, as previously described (13, 37, 38). An in vitro digestion assay with purified COMP and the cell lysates carrying ADAMTS-12 was then performed. Briefly, purified COMP (200 nm) was incubated with the cell lysates and medium prepared from COS-7 or HEK293 cells transfected with the above-mentioned plasmids in a digestion buffer (50 mm Tris-HCl, 100 mm NaCl, 5 mm CaCl2,2mm ZnCl2 0.05% Brij-35, pH 7.5) at 37 °C for 12 h. The digested products were analyzed as described above. Finally, we examined the degradation of COMP mediated by purified ADAMTS-12. Briefly, medium was collected from COS-7 or HEK293 cells transfected with the above-mentioned plasmids and 50 μl of anti-FLAG M2 antibody (Sigma) was added to the medium followed by 50 μl of protein A-agarose. After washing, purified ADAMTS-12 was incubated with purified COMP and the digestion performed as described above.

To determine whether the enzymatic activity of ADAMTS-12 depends on divalent cations, purified COMP substrate (250 nm)was incubated with purified catalytic domain of ADAMTS-12 (25 nm)in digestion buffer (50 mm Tris-HCl, 100 mm NaCl, pH 7.5) supplemented with 5 mm CaCl2,2mm ZnCL2, 2.5 mm MgCl2,5mm EDTA or various combinations at 37 °C for 12 h. The digested products were resolved by 10% nonreduced SDS-PAGE, and the gel were stained with Coomassie Brilliant Blue G-Colloidal solution.

To test the enzymatic activity of ADAMTS-12 in the presence of different amount of Zn2+ or at different pH values, the same digestion was performed in a buffer (50 mm Tris-HCl, 100 mm NaCl, 5 mm CaCl2, 2.5 mm MgCl2) containing various concentration of Zn2+ (0, 0.5 mm, 1.0 mm, 2.0 mm, 4.0 mm 8.0 mm) or in a buffer (50 mm Tris-HCl, 100 mm NaCl, 5 mm CaCl2, 2.0 mm Zn Cl2, 2.5 mm MgCl2) at various pH values (4.5, 5.5, 6.5, 7.5, 8.5, 9.5, 10.5, 11.5) at 37 °C for 12 h, and digested proteins were processed as above.

RNA Preparation and Reverse Transcription PCR—Human meniscus, bone, cartilage, synovium, ligament, tendon, fat, and skeletal muscle obtained from four normal human knees (provided by the Musculoskeletal Transplant Foundation, Edison, NJ), were frozen immediately after isolation and ground under liquid nitrogen (41). Total RNA was extracted by the acid-guanidium thiocyanate-phenol-chloroform single-step method followed by RNAeasy kit (Qiagen, Valencia, CA). One microgram of total RNA per sample was reverse-transcribed using the ImProm-II Reverse Transcription system (Promega). The following sequence-specific primers were synthesized: 5′-GTGGAACGGGAAC-TATAAGCTG-3′ and 5′-GTTTCAGAACTCTCCGGCTAGA-3′ for human ADAMTS-12. The following pair of oligonucleotides was used as internal controls: 5′-TGAAGGTCGGAGTCAACGGATTTGGT-3′ and 5′-CATGTGGGCCATGAGGTCCACCAC-3′ for human GAPDH.

PCR was performed for 35 cycles (94 °C 1 min, 60 °C 1 min, and 72 °C 1 min) with a final elongation for 10 min at 72 °C. GAPDH was also amplified as an internal control for 35 cycles (94 °C 1 min, 55 °C 1 min, 72 °C 1.5 min). The PCR product was analyzed by 1% agarose gel electrophoresis and further sequenced by the Applied Biosystems sequencing system (Foster City, CA).

Expression of ADAMTS-12 in Arthritic Tissues Assayed by TaqMan Real Time PCR—Normal adult articular cartilage and synovium were obtained from the knees of four patients (mean age 56.7 years, range 43-64 years) who had died of diseases unrelated to arthritis (specimens obtained en bloc from the Musculoskeletal Transplant Foundation). The grade of osteoarthritis was determined using the Kellgren-Lawrence Grading System (42). Normal tissues samples were without radiographic or intraarticular evidence of arthritic disease (Kellgren-Lawrence, Grade 0). Arthritic cartilage and synovium were obtained from 12 patients undergoing elective total knee arthroplasty for end-stage arthritis: OA articular cartilage (Kellgren-Lawrence, Grade 3 or 4) from the distal femora of 8 patients (mean age: 58.4 years, range 49-66 years) and RA cartilage (American College of Rheumatology Stage III and IV disease) and synovium from the knees of 4 RA patients (mean age: 57.8, range 45-67) who fulfilled the revised criteria of the American College of Rheumatology for the diagnosis of RA (43).

Following total RNA extraction and reverse transcription, real-time PCR was performed using a sequence-specific probe and primers for ADAMTS-12 (fluorescence-labeled oligonucleotide probes (using 6-carboxy-fluorescein (FAM)) probe: AGGACATCTGTGCTGGTTT-CAATCGCC; primers: CACGACGTGGCTGTCCTTCT and CCGAA-TCTTCATTGATGTTACAACTG). The correction of the PCR products obtained was confirmed by direct sequencing of the amplicons. A standard curve with copy numbers ranging from 103 to 109 was produced using human cartilage cDNA as the template. An XY scatter plot was produced using Microsoft Excel software, and the equation y = mx + b (where m = the slope of the standard curve and b = the y-intercept of that line) was calculated and R2 values obtained. As an internal control, 18 S rRNA was analyzed in parallel by using the Endogenous Control Human rRNA kit (Applied Biosystems).

PCR reactions for all samples were performed in duplicate in 96-well optical plates with 5 ng of cDNA (1 ng of cDNA for the 18 S rRNA), 100 nm probe, 200 nm each primer, and 10.0 μl of TaqMan Universal 2× PCR Master Mix (PE-Applied Biosystems, St. Louis, MO) in a 20-μl reaction volume. The amplification reaction was carried out over 40 cycles (an initial holding stage of 2 min at 50 °C and then 10 min at 95 °C, followed by a two-step cycling program of 15 s at 95 °C and 1 min at 60 °C).

RESULTS

ADAMTS-12 Associates with COMP in Yeast—Our unpublished observation that the EGF-like domain of COMP binds to the C-terminal TSP1-like repeats of ADAMTS-7, whose domain organization and structure are similar to those of ADAMTS-12, prompted us to investigate whether ADAMTS-12 interacts with COMP. For this purpose, the four C-terminal TSP1-like repeats of ADAMTS-12 (amino acids 1316-1530) were subcloned into a yeast expression pPC86 vector and a yeast two-hybrid assay performed (Fig. 1A). Briefly, the plasmid encoding the EGF-like domain of COMP (amino acids 84-261) linked to Gal4DBD (above the line in Fig. 1B) and the plasmid encoding the four C-terminal TSP1-like repeats of ADAMTS-12 fused to VP16AD (below the line) were used to cotransform the yeast strain MAV203. Plasmid pairs encoding c-Jun/c-Fos and Rb/lamin were used as positive and negative protein-protein interaction controls, respectively. Interaction between the C-terminal polypeptide of ADAMTS-12 and the EGF-like domain of COMP was resolved by a β-galactosidase assay and growth phenotype on selective media (Fig. 1B). Like the c-Jun/c-Fos pair, which are known to interact, the EGF-like domain of COMP was shown to interact with the C-terminal of ADAMTS-12 in yeast based on β-galactosidase activity (Fig. 1B, left) and growth inhibition on plates containing 5-fluoroorotic acid (two hybrid-dependent activation of URA3 results in conversion of 5-fluoroorotic acid to 5-fluorouracil, which is toxic). Hence, the growth of yeast containing interacting proteins is inhibited when plated on the medium containing 5-fluoroorotic acid (Fig. 1B, right).

FIGURE 1
Binding of COMP to ADAMTS-12 in yeast. A, domain organization of ADAMTS-12. The C-terminal COMP binding region is indicated. B, yeast two-hybrid assay to test the interaction of proteins fused to the VP16 AD and proteins fused to the Gal4 DBD. Each pair ...

Direct Binding of COMP to the C-terminal Polypeptide of ADAMTS-12 in Vitro—The interaction between COMP and ADAMTS-12 was also confirmed using in vitro GST pulldown assays. Briefly, affinity-purified GST and a purified COMP EGF-like domain (amino acids 84-261) as a GST fusion protein (GST-EGF) that were immobilized on glutathione-Sepharose beads were incubated with cell extracts prepared from COS-7 cells transfected with an expression plasmid encoding either wild-type ADAMTS-12 (TS-12, Fig. 2A) or ADAMTS-12 with mutant catalytic domain (TS-12mut, Fig. 2B) (39). After washing, glutathione-Sepharose bead bound proteins were resolved by 10% SDS-PAGE and Western blotting. Purified GST did not pull down either wild-type or mutant ADAMTS-12 (Fig. 2A, lane 2 and B, lane 2), whereas GST-EGF efficiently pulled down these proteins (Fig. 2A, lane 3 and B, lane 3), indicating that the EGF-like domain of COMP binds to the ADAMTS-12 in vitro.

FIGURE 2
COMP associates with ADAMTS-12 both in vitro and in vivo. A and B, GST pull-down assay. Purified GST or GST-EGF fusion protein immobilized on glutathione-Sepharose beads were incubated with cell extracts bearing either HA-tagged wild-type ADAMTS-12 (TS-12, ...

The interaction between COMP and ADAMTS-12 was also characterized by an in vitro solid-liquid phase titration experiment in which the dilution series of recombinant His-TS12C4TSP and purified COMP showed dose-dependent binding and saturation to the liquid-phase COMP (Fig. 2C). The interaction between COMP and ADAMTS-12 is direct, since both COMP and the C-terminal four TSP-1-like repeats were used as purified recombinant proteins.

Binding of COMP to ADAMTS-12 in Mammalian Cells—We next performed a coimmunoprecipitation assay to determine whether ADAMTS-12 associates with COMP in vivo (Fig. 2D). COMP stable cell lines were transfected with a mammalian expression pcDNA3-ADAMTS12-HA plasmid that encodes HA-tagged ADAMTS-12 (provided by Drs. Cal and Lopez-Otin) (39). The cell extracts prepared from those transfected cells were first incubated with control IgG (negative control), anti-COMP (positive control), or anti-HA, and the complexes were detected with anti-COMP polyclonal antiserum. A specific COMP band was immunoprecipitated by anti-COMP antibodies (lane 3) and anti-HA antibodies (lane 4), but not by control IgG antibodies (lane 2), demonstrating that ADAMTS-12 specifically associates with COMP in vivo.

Selective Association of ADAMTS-12 with the EGF-like Domain of COMP—As shown in Fig. 1, ADAMTS-12 associates with the EGF-like domain of COMP. We also investigated whether ADAMTS-12 interacts with the other three functional domains of COMP, including the N-terminal pentamerizing domain, the type III domain, and the C-terminal global domain. For this purpose, filter-based β-galactosidase assays were performed to determine whether coexpression of the various domains of COMP/Gal4DBD and ADAMTS-12/VP16AD fusion proteins activate the reporter LacZ gene. As shown in Fig. 3, of the four functional domains tested, ADAMTS-12 selectively interacts with only the EGF-like domain of COMP.

FIGURE 3
ADAMTS-12 selectively binds to the EGF-like domain of COMP. A, schematic structure of COMP constructs used to map those domains (N-terminal, EGF-like, type III, and C-terminal) that bind to ADAMTS-12. Presence or absence of binding between COMP domains ...

Four C-terminal TSP1-like Repeats of ADAMTS-12 Are Necessary and Sufficient for Binding COMP—To identify the COMP binding domain in ADAMTS-12, we generated various constructs that expressed various ADAMTS-12 deletion mutants in yeast. Results from filter-based β-galactosidase assays (Fig. 4B) of all these mutants are summarized in Fig. 4A. The ADAMTS-12 prodomain, the metalloproteinase, disintegrin-like, and cysteine-rich domains, and the spacer-1 plus three TSP repeats all failed to bind to COMP. As expected, the spacer-2 plus four C-terminal TSP-1-like repeats bound to COMP. When the spacer-2 domain was removed, the binding to COMP was not disturbed, indicating that this domain is not required for binding. Further removal of four TSP-1-like repeats eliminated binding, indicating that four TSP-1-like repeats in the C-terminal are required. When four TSP-1-like repeats were used, however, COMP binding occurred. Our conclusion from this set of experiments is that that four C-terminal TSP-1-like repeats of ADAMTS-12 are required and sufficient for its interaction with COMP.

Cleavage of COMP by Recombinant ADAMTS-12 in Vitro—Once the interaction between ADAMTS-12 and COMP was established, cotransfection assays were performed to determine whether ADAMTS-12 has COMP-degrading activity. A COMP stable line was transfected with empty pcDNA3 vector, wild-type ADAMTS-12 (pFLAG-TS-12), or ADAMTS-12 with mutant catalytic domain (pTS-12mut), and the medium collected and detected by Western blotting with anti-COMP antibodies (13, 37, 38). As shown in Fig. 5A, the COMP stable cells transfected with either empty vector (lane 3) or mutant ADAMTS-12 (in which two crucial amino acids in the catalytic domain of ADAMTS-12 were mutated) (39) (lane 2) did not show any COMP-degrading activity, but wild-type ADAMTS-12 (lane 1) digested COMP and produced one major fragment with an apparent molecular mass of ~100 kDa (large arrowhead) and two minor fragments (small arrow-heads). We verified the COMP-cleaving activity of ADAMTS-12 by an in vitro digestion assay with purified COMP and the cell lysates expressing ADAMTS-12 or its mutant. As indicated in Fig. 5B, cell extracts transfected with an empty vector (lane 1) did not result in any COMP-degrading activity, but wild-type ADAMTS-12 (lane 2) showed COMP-degrading activity. In addition, enzymatic activity was dramatically reduced when the two crucial amino acids in the catalytic domain of ADAMTS-12 were mutated (39) (lane 3). COMP-degrading activity by ADAMTS-12 was further demonstrated by digestion performed with purified ADAMTS-12 (Fig. 5C).

FIGURE 5
In vitro digestion assays of COMP mediated by ADAMTS-12. A, COMP digestion by ADAMTS-12, assayed by cotransfection experiments. The COMP stable line was transfected with either control (lane 3) or expression constructs encoding wild-type ADAMTS-12 (pFLAG-TS12, ...

Cleavage of COMP by ADAMTS-12 Is Zn2+- and pH-dependent—It was reported that the catalytic domain of ADAMTS-20 produced in bacteria can digest its substrates in vitro (44). Using a similar method, we purified the catalytic domain (amino acids 241-464) of ADAMTS-12 as a GST fusion protein (GST-TS12-CD) in bacteria. The GST moiety was further removed by a Xa factor, and the purity of proteins was confirmed by silver staining (not shown). The recombinant catalytic domain of ADAMTS-12 was employed in the following in vitro digestion assays. To determine whether ADAMTS-12-mediated COMP cleavage requires the involvement of cations, including Ca2+, Zn2+, and/or Mg2+, purified COMP substrate and ADAMTS-12 enzyme were incubated in digestion buffer in the presence or absence of various cations (Fig. 5D). A degraded COMP fragment (arrow in Fig. 5D) was detectable in the digestion buffer with Zn2+ (lane 6) but was undetectable in the digestion buffer with Ca2+ (lane 5) or Mg2+ (lane 7) used alone. In the presence of Zn2+ (compare lanes 8 and 10), the addition of Ca2+ changed the electrophoretic mobility of the COMP-digested fragment, probably due to a conformation change in COMP. Mg2+ seems not to affect COMP digestion by ADAMTS-12, since it did not affect the electrophoretic mobility of the COMP-digested fragment when used alone or in combination with other cations (compare lanes 10 and 7).

Because Zn2+ is essential for the enzymatic activity of ADAMTS-12, we next performed an in vitro digestion assay with different Zn2+ concentrations (0, 0.5, 1.0, 1.5, 2.0, 4.0, 6.0, and 8.0 mm) to determine the optimum concentration of Zn2+ for ADAMTS-12 activity (Fig. 5E). The highest enzymatic activity was observed in the presence of 2 mm of ZnCl2, and the amount of digested COMP was dramatically reduced or totally abolished in the presence of higher amounts of ZnCl2 (4 or 8 mm).

In vitro digestions were performed at various pH values in order to examine its regulation of ADAMTS-12 activity. As shown in Fig. 5F, ADAMTS-12 generated the largest amount of COMP fragments in the range of physiological pH (pH 7.5) up to pH 9.5, whereas the enzyme did not produce visible COMP fragments at pH values lower than 6.5 or higher than 10.5, indicating that the digestive activity of ADAMTS-12 is pH-dependent.

Musculoskeletal Tissues Distribution of ADAMTS-12—The fact that COMP is predominately expressed in the musculoskeletal tissues, together with our findings that ADAMTS-12 binds to and cleave COMP, prompted us to test the expression of ADAMTS-12 in musculoskeletal tissues. Reverse-transcription PCR (RT-PCR) assay was performed to examine the expression of ADAMTS-12 mRNA in eight specimens of normal human musculoskeletal tissue. As seen in Fig. 6A, the 733-bp hADAMTS-12 fragment was amplified using ADAMTS-12-specific primers from cartilage, synovium, and tendon in which COMP was also present (3, 4). ADAMTS-12 is also detectable in skeletal muscle and fat. However, ADAMTS-12 was undetectable in meniscus, bone, and ligament. These results demonstrate that while ADAMTS-12 is coexpressed in COMP-producing musculoskeletal tissues, it has a wider tissue distribution (3, 4, 38, 46).

FIGURE 6
Increased expression of ADAMTS-12 in the cartilage and synovium of arthritis patients. A, expression assay of ADAMTS-12 in human musculoskeletal tissues by RT-PCR. Amplification products are consistent with a predicted size of 733 bp for ADAMTS-12 and ...

Increased Expression of ADAMTS-12 in the Cartilage and Synovium of Patients with Arthritis—To determine whether the expression of ADAMTS-12 in cartilage and synovium is altered in OA or RA, a quantitative real-time PCR was performed using a sequence-specific probe and primers for ADAMTS-12. Total RNA was extracted from adult age-matched normal and arthritic tissues (articular cartilage and synovium). As shown in Fig. 6B, ADAMTS-12 mRNA was significantly upregulated in both OA and RA cartilage (p < 0.05 and p < 0.001, respectively) compared with the normal control. Further analysis of synovium samples revealed that the level of ADAMTS-12 was also significantly up-regulated in RA synovium compared with normal synovium (p < 0.001, Fig. 6C).

DISCUSSION

The present study demonstrates that ADAMTS-12 binds to the EGF-like repeat domain of COMP via its four C-terminal TSP-1 like repeats and that ADAMTS-12-mediated COMP degradation is Zn2+- and pH-dependent (Figs. (Figs.33--5).5). In view of the fact that prominent COMP degradative fragments in OA and RA are produced by cleavage within the COMP EGF-like molecular domain, the binding of ADAMTS-12 to this same region with subsequent COMP cleavage is strong evidence that ADAMTS-12 plays an important role in COMP degradation (13).

COMP interacts with multiple protein partners; these interactions are important for the COMP physiologic functions and cytoplasmic processing and transport. COMP can mediate chondrocyte attachment through interactions with integrins. Through these interactions, COMP may be able to regulate cellular activities and respond to environment in the surrounding cartilage matrix (3, 47). Several reports suggest that COMP may function to stabilize the articular cartilage extracellular matrix by specific cation-dependent interactions with matrix components, including collagen types II and IX, fibronectin, aggrecan, and matrilin-1, -3, and -4 (10, 48-51). COMP has also been shown to associate with several chaperone proteins, including BiP, calreticulin, protein disulfide, ERp72, Grp94, HSP47, and calnexin, and it has been proposed that these associations facilitate the processing and transport of wild-type COMP in normal chondrocytes and in the retention of mutant COMP in pseudoachondroplasia chondrocytes (52-54). In addition to the interactions between COMP and its protein partners, the five-stranded N-terminal domain of COMP forms a complex with vitamin D-3, illustrating that COMP has storage function for hydrophobic compounds, including prominent cell signaling molecules (55).

Purified COMP has been reported to be digested in vitro by several members from the family of matrix metalloproteinases (MMPs), including interstitial collagenase (MMP-1), collagenase-3 (MMP-13), strome-lysin-1 (MMP-3), gelatinase-B (MMP-9), MMP-19, and enamelysin (MMP-20) (56). It was also shown that ADAMTS-4 is able to cleave purified COMP in an in vitro digestion assay and that the resultant fragment has a molecular mass similar to one of the fragments observed in OA and RA samples (57); all these assays, however, were performed using an in vitro digestion system in which both enzymes and substrates were at higher concentrations than those in physiological/pathological conditions. None of these metalloproteinases has been found capable of associating with COMP, which is probably necessary for COMP degradation in vivo. Results from this study using ADAMTS-12 comprehensive protein-protein interactions and enzymatic activities assays clearly show that ADAMTS-12 can bind to and cleave COMP (Figs. (Figs.11--55).

The C-terminal domain of metalloproteinases were found to be important for binding substrates and determining enzyme selectivity; data from chimeric constructs indicate that collagenases, stromelysins, and gelatinases interact with their macromolecular substrates via this domain (see the review by Martel Pelletier, Ref. 62). The matrix-binding properties of ADAMTS-1 appear to be related to the number of TSP repeats in its C-terminal region (63), and our finding that four C-terminal TSP repeats of ADAMTS-12 are required and sufficient for binding to COMP also supports this concept. Recent studies also provide evidence that ADAMTS-4 interacts with aggrecan via its cysteine-rich/spacer domains (64), whereas its C-terminal region plays a major role in regulating aggrecanase activity by masking its general proteolytic activity (65).

In addition to their substrates, the enzymatic activities of ADAMTS proteins may be regulated by their associated proteins, and several ADAMTS binding partners have been isolated. α2-Macroglobulin was found to form protein complexes with ADAMTS-4 and ADAMTS-5 and represents an endogenous inhibitor of these enzymes (58). It was also reported that the aggrecanase activity of ADAMTS-4 is inhibited by fibronectin through interaction with its C-terminal domains, suggesting that this extracellular regulation mechanism of ADAMTS-4 activity may be important for the degradation of aggrecan in arthritic cartilage (59). ADAMTS-4 also associates with α1-antitrypsin a member of the family of plasma serine proteinase inhibitors, but the physiological significance of the interaction between them remains unclear (60). The extracellular matrix protein fibulin-1 was identified as an ADAMTS-1 interacting molecule in a yeast-two-hybrid screen, and fibulin-1 was found to enhance the capacity of ADAMTS-1 to cleave aggrecan, indicating that fibulin-1 is a regulator of ADAMTS-1-mediated proteoglycan proteolysis and thus may play an important role in proteoglycan turnover (61).

As shown in Fig. 5, D and E, the COMP-degrading activity of ADAMTS-12 depends on the presence of appropriate cations; this dependence was further verified with EDTA chelator, since 5 mm EDTA totally abolished COMP digestion mediated by ADAMTS-12 (not shown). ADAMTS-12 demonstrated highest enzymatic activities in the presence of 2 mm Zn2+, whereas most metalloproteinases usually require lower concentrations of Zn2+ for cleaving their substrates (e.g. 0.1 mm). The differences in metal requirements between metalloproteinases may indicate a difference in the cation dependence of these enzymes. A good example in this regard is the matrix metalloproteinases gelatinases. The 68,000 and 130,000 gelatinases are active at higher concentration of Zn2+ (2 mm), but 60,000 gelatinase is active at a very low concentration of Zn2+ (5 μm) (45).

Reverse-transcription PCR was employed to examine the expression of ADAMTS-12 in human musculoskeletal tissues and revealed that ADAMTS-12 is expressed in COMP-expressing tissues, including cartilage, synovium, and tendon (Fig. 6A). A real time PCR assay performed to compare the expression profile of the ADAMTS genes in OA and normal cartilage showed that ADAMTS-12 mRNA was significantly up-regulated in OA cartilage (p < 0.05) (1). This finding is in agreement with our quantitative real time PCR assays using OA cartilage; we also found, however, that ADAMTS-12 is significantly up-regulated in cartilage and synovium obtained from patients with RA (p < 0.001, Fig. 6, B and C), suggesting that ADAMTS-12 plays an important role in joint degenerative disease progression. The increased expression of ADAMTS-12 in the joint tissues of arthritic patients may be caused by proinflammatory cytokines, including TNF-α and IL-1β (not shown).

Our identification of ADAMTS-12 as a COMP-binding protein and subsequent characterization of the enzyme/substrate association and COMP degradation mediated by ADAMTS-12 significantly extend our understanding of the degradative events that occur in joint disorders and promise to increase our ability to monitor the biological and physical properties of cartilage extracellular matrix. Because the levels of ADAMTS-12 are significantly increased in the cartilage and synovium of arthritis patients, this enzyme appears to play an important role in the pathophysiology of cartilage degradation in arthritis.

Acknowledgments

Acknowledgments—We thank Drs. S. Cal and C. Lopez-Otin, Universidad de Oviedo, Barcelona, Spain for generously providing plasmids and the Musculoskeletal Transplant Foundation for providing human tissues.

Footnotes

*This work was supported by National Institutes of Health Research Grant AR052022 (to C. J. L.) and the New York Chapter of the Arthritis Foundation Dorothy W. Goldstein Young Scholar Award (to C. J. L.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

3The abbreviations used are:

OA
osteoarthritis
COMP
cartilage oligomeric matrix protein
ADAMTS
a disintegrin and metalloproteinase with thrombospondin motifs
MMP
matrix metalloproteinases
RA
rheumatoid arthritis
RT-PCR
reverse transcription polymerase chain reaction
TSP
thrombospondin
GAPDH
glyceraldehyde-3-phosphate dehydrogenase
GST
glutathione S-transferase
DBD
DNA binding domain
SD
synthetic dropout (base)
FOA
fluoroorotic acid
CD
catalytic domain
EGF
epidermal growth factor
HA
hemagglutinin

REFERENCES

1. Kevorkian L, Young DA, Darrah C, Donell ST, Shepstone L, Porter S, Brock-bank SM, Edwards DR, Parker AE, Clark IM. Arthritis Rheum. 2004;50:131–141. [PubMed]
2. Salzet M. Curr. Pharm. Des. 2002;8:493–503. [PubMed]
3. DiCesare P, Hauser N, Lehman D, Pasumarti S, Paulsson M. FEBSLett. 1994;354:237–240. [PubMed]
4. Hedbom E, Antonsson P, Hjerpe A, Aeschlimann D, Paulsson M, Rosa-Pimentel E, Sommarin Y, Wendel M, Oldberg A, Heinegard D. J. Biol. Chem. 1992;267:6132–6136. [PubMed]
5. Morgelin M, Engel J, Heinegard D, Paulsson M. J. Biol. Chem. 1992;267:14275–14284. [PubMed]
6. Oldberg A, Antonsson P, Lindblom K, Heinegard D. J. Biol. Chem. 1992;267:22346–22350. [PubMed]
7. Saxne T, Heinegard D. Br. J. Rheumatol. 1992;31:583–591. [PubMed]
8. Neidhart M, Hauser N, Paulsson M, DiCesare PE, Michel BA, Hauselmann HJ. Br. J. Rheumatol. 1997;36:1151–1160. [PubMed]
9. Lohmander LS, Ionescu M, Jugessur H, Poole AR. Arthritis Rheum. 1999;42:534–544. [PubMed]
10. Mansson B, Carey D, Alini M, Ionescu M, Rosenberg LC, Poole AR, Heinegard D, Saxne T. J. Clin. Investig. 1995;95:1071–1077. [PMC free article] [PubMed]
11. Petersson IF, Boegard T, Svensson B, Heinegard D, Saxne T. Br. J. Rheumatol. 1998;37:46–50. [PubMed]
12. Lohmander LS, Saxne T, Heinegard DK. Ann. Rheum. Dis. 1994;53:8–13. [PMC free article] [PubMed]
13. Di Cesare PE, Carlson CS, Stolerman ES, Hauser N, Tulli H, Paulsson M. J. Orthop. Res. 1996;14:946–955. [PubMed]
14. Apte SS. Int. J. Biochem. Cell Biol. 2004;36:981–985. [PubMed]
15. Porter S, Clark IM, Kevorkian L, Edwards DR. Biochem. J. 2005;386:15–27. [PMC free article] [PubMed]
16. Abbaszade I, Liu RQ, Yang F, Rosenfeld SA, Ross OH, Link JR, Ellis DM, Tortorella MD, Pratta MA, Hollis JM, Wynn R, Duke JL, George HJ, Hillman MC, Jr., Murphy K, Wiswall BH, Copeland RA, Decicco CP, Bruckner R, Nagase H, Itoh Y, Newton RC, Magolda RL, Trzaskos JM, Burn TC, Hollis GF, Arner EC. J. Biol. Chem. 1999;274:23443–23450. [PubMed]
17. Collins-Racie LA, Flannery CR, Zeng W, Corcoran C, Annis-Freeman B, Agostino MJ, Arai M, DiBlasio-Smith E, Dorner AJ, Georgiadis KE, Jin M, Tan XY, Morris EA, LaVallie ER. Matrix Biol. 2004;23:219–230. [PubMed]
18. Kuno K, Okada Y, Kawashima H, Nakamura H, Miyasaka M, Ohno H, Matsushima K. FEBS Lett. 2000;478:241–245. [PubMed]
19. Kuno K, Bannai K, Hakozaki M, Matsushima K, Hirose K. Biochem. Biophys. Res. Commun. 2004;319:1327–1333. [PubMed]
20. Tortorella MD, Burn TC, Pratta MA, Abbaszade I, Hollis JM, Liu R, Rosenfeld SA, Copeland RA, Decicco CP, Wynn R, Rockwell A, Yang F, Duke JL, Solomon K, George H, Bruckner R, Nagase H, Itoh Y, Ellis DM, Ross H, Wiswall BH, Murphy K, Hillman MC, Jr., Hollis GF, Newton RC, Magolda RL, Trzaskos JM, Arner EC. Science. 1999;284:1664–1666. [PubMed]
21. Tortorella MD, Pratta M, Liu RQ, Austin J, Ross OH, Abbaszade I, Burn T, Arner E. J. Biol. Chem. 2000;275:18566–18573. [PubMed]
22. Stanton H, Rogerson FM, East CJ, Golub SB, Lawlor KE, Meeker CT, Little CB, Last K, Farmer PJ, Campbell IK, Fourie AM, Fosang AJ. Nature. 2005;434:648–652. [PubMed]
23. Glasson SS, Askew R, Sheppard B, Carito B, Blanchet T, Ma HL, Flannery CR, Peluso D, Kanki K, Yang Z, Majumdar MK, Morris EA. Nature. 2005;434:644–648. [PubMed]
24. Randy JD, Westling J, Kenagy RD, Iruela-Arispe ML, Verscharen C, Rodriguez-Mazaneque JC, Zimmermann DR, Lemire JM, Fischer JW, Wight TN, Clowes AW. J. Biol. Chem. 2001;276:13372–13378. [PubMed]
25. Matthews RT, Gary SC, Zerillo C, Pratta M, Solomon K, Arner EC, Hockfield S. J. Biol. Chem. 2000;275:22695–22703. [PubMed]
26. Colige A, Vandenberghe I, Thiry M, Lambert CA, Van Beeumen J, Li SW, Prockop DJ, Lapiere CM, Nusgens BV. J. Biol. Chem. 2002;277:5756–5766. [PubMed]
27. Fernandes RJ, Hirohata S, Engle JM, Colige A, Cohn DH, Eyre DR, Apte SS. J. Biol. Chem. 2001;276:31502–31509. [PubMed]
28. Colige A, Sieron AL, Li SW, Schwarze U, Petty E, Wertelecki W, Wilcox W, Krakow D, Cohn DH, Reardon W, Byers PH, Lapiere CM, Prockop DJ, Nusgens BV. Am. J. Hum. Genet. 1999;65:308–317. [PMC free article] [PubMed]
29. Dong JF, Moake JL, Nolasco L, Bernardo A, Arceneaux W, Shrimpton CN, Schade AJ, McIntire LV, Fujikawa K, Lopez JA. Blood. 2002;100:4033–4039. [PubMed]
30. Soejima K, Matsumoto M, Kokame K, Yagi H, Ishizashi H, Maeda H, Nozaki C, Miyata T, Fujimura Y, Nakagaki T. Blood. 2003;102:3232–3237. [PubMed]
31. Dong JF, Moake JL, Bernardo A, Fujikawa K, Ball C, Nolasco L, Lopez JA, Cruz MA. J. Biol. Chem. 2003;278:29633–29639. [PubMed]
32. Lopez JA, Dong JF. Semin. Hematol. 2004;41:15–23. [PubMed]
3. Tao Z, Peng Y, Nolasco L, Cal S, Lopez-Otin C, Li R, Moake JL, Lopez JA, Dong JF. Blood. 2005;106:4139–4145. [PMC free article] [PubMed]
34. Liu CJ, Wang H, Lengyel P. EMBO J. 1999;18:2845–2854. [PMC free article] [PubMed]
35. Vojtek AB, Hollenberg SM, Cooper JA. Cell. 1993;74:205–214. [PubMed]
36. Hollenberg SM, Sternglanz R, Cheng PF, Weintraub H. Mol. Cell. Biol. 1995;15:3813–3822. [PMC free article] [PubMed]
37. Di Cesare PE, Fang C, Leslie MP, Della Valle CJ, Gold JM, Tulli H, Perris R, Carlson CS. J. Orthop. Res. 1999;17:437–445. [PubMed]
38. Di Cesare PE, Fang C, Leslie MP, Tulli H, Perris R, Carlson CS. J. Orthop. Res. 2000;18:713–720. [PubMed]
39. Cal S, Arguelles JM, Fernandez PL, Lopez-Otin C. J. Biol. Chem. 2001;276:17932–17940. [PubMed]
40. Liu CJ, Ding B, Wang H, Lengyel P. Mol. Cell. Biol. 2002;22:2893–2905. [PMC free article] [PubMed]
41. Chen AL, Fang C, Liu C, Leslie MP, Chang E, Di Cesare PE. J. Orthop. Res. 2004;22:1188–1192. [PubMed]
42. Kellgren JH, Lawrence JS. Ann. Rheum. Dis. 1957;16:494–502. [PMC free article] [PubMed]
43. Arnett FC, Edworthy SM, Bloch DA, McShane DJ, Fries JF, Cooper NS, Healey LA, Kaplan SR, Liang MH, Luthra HS. Arthritis Rheum. 1988;31:315–324. [PubMed]
44. Llamazares M, Cal S, Quesada V, Lopez-Otin C. J. Biol. Chem. 2003;278:13382–13389. [PubMed]
45. Ambili M, Sudhakaran PR. J. Cell. Biochem. 1999;73:218–226. [PubMed]
46. DiCesare PE, Carlson CS, Stollerman ES, Chen FS, Leslie M, Perris R. FEBS Lett. 1997;412:249–252. [PubMed]
47. Chen FH, Thomas AO, Hecht JT, Goldring MB, Lawler J. J. Biol. Chem. 2005;280:32655–32661. [PMC free article] [PubMed]
48. Chen FH, Thomas AO, Zhang F, Hecht JT, Lawler J. 50th Annual Meeting of Orthopaedic Research Society; San Francisco, CA. 7-10.Mar, 2004.
49. Di Cesare PE, Chen FS, Moergelin M, Carlson CS, Leslie MP, Perris R, Fang C. Matrix Biol. 2002;21:461–470. [PubMed]
50. Rosenberg K, Olsson H, Morgelin M, Heinegard D. J. Biol. Chem. 1998;273:20397–20403. [PubMed]
51. Mann HH, Ozbek S, Engel J, Paulsson M, Wagener R. J. Biol. Chem. 2004;279:25294–25298. [PubMed]
52. Hecht JT, Hayes E, Snuggs M, Decker G, Montufar-Solis D, Doege K, Mwalle F, Poole R, Stevens J, Duke PJ. Matrix Biol. 2001;20:251–262. [PubMed]
53. Duke J, Montufar-Solis D, Underwood S, Lalani Z, Hecht JT. Apoptosis. 2003;8:191–197. [PubMed]
54. Vranka J, Mokashi A, Keene DR, Tufa S, Corson G, Sussman M, Horton WA, Maddox K, Sakai L, Bachinger HP. Matrix Biol. 2001;20:439–450. [PubMed]
55. Ozbek S, Engel J, Stetefeld J. EMBO J. 2002;21:5960–5968. [PMC free article] [PubMed]
56. Stracke JO, Fosang AJ, Last K, Mercuri FA, Pendas AM, Llano E, Perris R, Di Cesare PE, Murphy G, Knauper V. FEBS Lett. 2000;478:52–56. [PubMed]
57. Dickinson SC, Vankemmelbeke MN, Buttle DJ, Rosenberg K, Heinegard D, Hollander AP. Matrix Biol. 2003;22:267–278. [PubMed]
58. Tortorella MD, Arner EC, Hills R, Easton A, Korte-Sarfaty J, Fok K, Wittwer AJ, Liu RQ, Malfait AM. J. Biol. Chem. 2004;279:17554–17561. [PubMed]
59. Hashimoto G, Shimoda M, Okada Y. J. Biol. Chem. 2004;279:32483–32491. [PubMed]
60. Yoshida K, Suzuki Y, Saito A, Fukuda K, Hamanishi C, Munakata H. Biochim. Biophys. Acta. 2005;1725:152–159. [PubMed]
61. Lee NV, Rodriguez-Manzaneque JC, Thai SN, Twal WO, Luque A, Lyons KM, Argraves WS, Iruela-Arispe ML. J. Biol. Chem. 2005;280:34796–34804. [PubMed]
62. Martel-Pelletier J, Welsch DJ, Pelletier JP. Best Pract. Res. Clin. Rheumatol. 2001;15:805–829. [PubMed]
63. Vazquez F, Hastings G, Ortega MA, Lane TF, Oikemus S, Lombardo M, Iruela-Arispe ML. J. Biol. Chem. 1999;274:23349–23357. [PubMed]
64. Flannery CR, Zeng W, Corcoran C, Collins-Racie LA, Chockalingam PS, Hebert T, Mackie SA, McDonagh T, Crawford TK, Tomkinson KN, LaVallie ER, Morris EA. J. Biol. Chem. 2002;277:42775–42780. [PubMed]
65. Kashiwagi M, Enghild JJ, Gendron C, Hughes C, Caterson B, Itoh Y, Nagase H. J. Biol. Chem. 2004;279:10109–10119. [PubMed]
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...