• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of pnasPNASInfo for AuthorsSubscriptionsAboutThis Article
Proc Natl Acad Sci U S A. Apr 25, 2006; 103(17): 6581–6586.
Published online Apr 17, 2006. doi:  10.1073/pnas.0509716103
PMCID: PMC1458926
Evolution

Development of bat flight: Morphologic and molecular evolution of bat wing digits

Abstract

The earliest fossil bats resemble their modern counterparts in possessing greatly elongated digits to support the wing membrane, which is an anatomical hallmark of powered flight. To quantitatively confirm these similarities, we performed a morphometric analysis of wing bones from fossil and modern bats. We found that the lengths of the third, fourth, and fifth digits (the primary supportive elements of the wing) have remained constant relative to body size over the last 50 million years. This absence of transitional forms in the fossil record led us to look elsewhere to understand bat wing evolution. Investigating embryonic development, we found that the digits in bats (Carollia perspicillata) are initially similar in size to those of mice (Mus musculus) but that, subsequently, bat digits greatly lengthen. The developmental timing of the change in wing digit length points to a change in longitudinal cartilage growth, a process that depends on the relative proliferation and differentiation of chondrocytes. We found that bat forelimb digits exhibit relatively high rates of chondrocyte proliferation and differentiation. We show that bone morphogenetic protein 2 (Bmp2) can stimulate cartilage proliferation and differentiation and increase digit length in the bat embryonic forelimb. Also, we show that Bmp2 expression and Bmp signaling are increased in bat forelimb embryonic digits relative to mouse or bat hind limb digits. Together, our results suggest that an up-regulation of the Bmp pathway is one of the major factors in the developmental elongation of bat forelimb digits, and it is potentially a key mechanism in their evolutionary elongation as well.

Keywords: Chiroptera, Bmp, cartilage

As a consequence of their achievement of powered flight, bats (order Chiroptera) underwent one of the greatest adaptive radiations in the history of mammalian evolution and now constitute one of every five mammalian species (1). A key innovation that enabled this extraordinary radiation is the bat wing. The bat wing consists of a membrane of skin stretched between dramatically elongated third, fourth, and fifth forelimb digits. Because of their importance in wing support, understanding the mechanisms that are responsible for the elongation of bat forelimb digits is key to understanding the evolutionary tempo and morphological transitions that underlie this major mammalian radiation.

Molecular phylogenetic evidence suggests that Chiroptera (consisting of both microbats and megabats) is a monophyletic clade that is nested within the Laurasiatheria, which is a group that comprises carnivorans, pangolins, ungulates, and “core” insectivores (or, eulipotyphlans; e.g., shrews, hedgehogs, moles, and solenodons) (25). There is a general consensus that the common ancestor of bats was a small, quadrupedal mammal, with a limb morphology that was similar to that of mice (6, 7). The earliest known bats appear in the fossil record ≈50 million years ago, and they appear suddenly and already possessing the anatomical hallmarks of powered flight (including elongated third, fourth, and fifth forelimb digits) (68). Thus, it seems to be likely that the earliest known fossil bats were already capable of powered flight (35). In the first component of this study, we used morphometric analyses to quantitatively demonstrate the similarity of the wing supportive digits between the earliest fossil and modern bats.

Because of the similarity between the forelimb digits of the earliest preserved and modern bats, the fossil record currently can provide little evidence of the evolutionary transitions that led to the elongation of bat forelimb digits and the associated evolution of powered flight in mammals, although this situation may change with the discovery of additional fossil material. The fossil record, as well as molecular-clock studies (2, 9), suggest that bats achieved powered flight in a few million years, which is a relatively short span of geologic time. However, these data do not preclude the morphological prerequisites of powered flight (e.g., elongated digits) having evolved by means of gradual processes.

Several studies (10, 11–15) have shown that major morphological transitions can be accommodated by a few key developmental genetic changes. Here, we provide functional and molecular comparisons of the development of the forelimb digits of the short-tailed fruit bat Carollia perspicillata with the digits of the bat hind limb and the digits of the forelimb of a more generalized quadruped, the mouse Mus musculus. Using these data, we identified uniquely derived developmental features of bat wing digits. Doing so allows us to highlight a key developmental genetic change and suggest evolutionary mechanisms underlying bat digit elongation.

Developmental elongation of the digits (and other long bones) is achieved by means of the relative rates of proliferation and differentiation of cartilage cells (chondrocytes) in the growth plate. Within the growth plate of developing digits, chondrocytes go through the following series of maturation steps: resting (in the Resting zone), proliferation (Proliferative zone), early differentiation (Prehypertrophic zone), and terminal differentiation (Hypertrophic zone) (16). Upon differentiation, chondrocyte cell division ceases. Subsequently, the hypertrophic chondrocytes secrete extracellular matrix in which ossification begins. When the cartilage matrix ossifies, the hypertrophic chondrocytes undergo apoptosis. Several genes that have a role in chondrocyte maturation have been identified (i.e., Ihh, Ffg genes, Bmp genes, and Pthrp, etc.). The bone morphogenetic protein (Bmp) family of secreted growth factors is of particular interest. Members of the Bmp family are involved in almost every aspect of chondrogenesis, from chondrocyte commitment to terminal differentiation (17). In the mouse limb, Bmps are weakly expressed within the growth plate in proliferating (Bmp7), prehypertrophic (Bmp4), and hypertrophic (Bmp2) cells, and they are moderately expressed in the perichondrium (a dense fibrous connective tissue) that surrounds the growth plate (Bmp2Bmp5 and Bmp7) (18). Proliferation and maturation of chondrocytes are the result of many complex interactions between the perichondrium and the growth plate. Bmp from both the perichondrium and the growth plate itself interacts with other factors within the growth plate and, thus, mediates chondrocyte maturation (17). Intriguingly, it has been shown that mouse and rat limbs that are cultured in the presence of Bmp2 protein increase in overall length, whereas mouse and rat limbs that are cultured in the presence of the Bmp antagonist Noggin result in stunted digits (19, 20). Bmp2 protein affects these changes by stimulating proliferation and the transition to hypertrophic differentiation and by inhibiting the most terminal stages of hypertrophic differentiation (19).

To determine the developmental basis of bat digit elongation, we compared the embryonic development of the digits of the bat forelimb and hind limb and mouse forelimb in terms of (i) their gross and cellular morphology throughout development; (ii) their relative rates of chondrocyte proliferation and differentiation during digit elongation; (iii) the response of the limbs to culture in the presence of Bmp2 protein or a Bmp antagonist (Noggin); and (iv) the expression of many important developmental genes, including several members of the Bmp family. Our results demonstrate that bat digit length can be altered in response to changes in Bmp. Also, we show that, in the bat forelimb, there is a dramatic change in the intensity of Bmp2 expression and Bmp signaling relative to the bat hind limb and mouse forelimb. This species- and limb-specific change suggests that Bmp2 has a major role in the developmental elongation of bat wing digits. By linking small changes in molecular patterning to dramatically different phenotypes, we provide a potential explanation for the evolution of the wings of bats, which is a key innovation in mammalian history.

Results

Forelimb Digits of Fossil and Modern Bats Are Highly Similar.

First, we compared the wing elements of the earliest known fossil (Fig. 1a) and modern bats (Fig. 1b) by using a morphometric analysis of length and width data from the forelimb bones of several fossil bats and representative species from many modern bat families. Independent regressions of the lengths of the metacarpals and phalanges of the third, fourth, and fifth digits (the primary supportive elements of the wing membrane) on a proxy for body size [principal component (PC)1] show that digits from extinct bats are not proportionally different from those of modern bats (Fig. 1c). As expected, PC1 was highly and evenly positively correlated with many variables (data not shown), suggesting that it is highly correlated with body size and, therefore, is an appropriate body-size proxy. These findings indicate that the bat wing digit proportions have not changed substantially during the past 50 million years of evolution.

Fig. 1.
The relative length of bat forelimb digits has not changed in 50 million years. (a) Icaronycteris index (American Museum of Natural History specimen no. 125000), which is a 50-million-year-old bat fossil. (b) Extant adult bat skeleton. The metacarpals ...

Initial Digit Condensations Are Similar in Proportion in Embryonic Bats and Mice.

To study when during ontogeny the changes in bat wing digit elongation occur, we examined embryonic stages of development and compared the bat forelimb with both the bat hind limb and mouse forelimb. Mice are thought to be similar in morphology to the ancestor of bats, and much is known about mouse limb development (21). The early cartilage condensations and segmentation (i.e., joint) patterns of the bat embryo (stage 16; Fig. 2a), as revealed by Alcian blue staining, are relatively similar in size and position to those of a comparably aged mouse embryo [embryonic day (E)12.5 or Carnegie stage 16; Fig. 2b] until bat stage 20. Examination of skeletal preparations of bat embryos from progressively later stages indicates that bat forelimb digits do not begin their rapid elongation relative to those of mouse until stage 20 (Fig. 2d).

Fig. 2.
Developmental elongation of bat digits occurs after the initial cartilage condensations are formed. (a and b) Cartilage revealed by Alcian blue staining of stage-16 bat forelimb (a; courtesy of C. Cretekos, University of Texas M. D. Anderson Cancer Center) ...

Later-Stage Bat Wing Digits Have a Greatly Enlarged Hypertrophic Zone and Increased Proliferation Relative to Mice.

To study the histological changes that may underlie the elongation of the bat wing digits, we examined the developing cartilage at the cellular level. These analyses reveal that the major difference in the morphology of the bat growth plate is a great expansion of the hypertrophic zone of differentiated chondrocytes in the metacarpals and phalanges of the third, fourth, and fifth digits, relative to mouse (Fig. 2c). In mice, the metacarpal hypertrophic zone comprises, at its maximum, ≈12% of the growth plate (Fig. 2c). At stages 18 and 19, bat forelimb metacarpals have a similar percentage of the growth plate occupied by the hypertrophic zone (Fig. 2 c and d). Strikingly, by stage 20, the relative size of the hypertrophic zones in the third, fourth, and fifth bat metacarpals have increased to >30% of the bat growth plate (Fig. 2d). This abrupt increase in the extent of the bat hypertrophic zone corresponds with the onset of exponential elongation in the bat forelimb digits (Fig. 2d). In addition to increased chondrocyte hypertrophy, bat forelimb digits also display increased rates of proliferation within the growth plate at stage 20 relative to bat hind limbs and mouse forelimbs of comparable stages, as revealed by phospho-histone H3 (Ser-10) Ab staining (Fig. 3ac).

Fig. 3.
Proliferation and Bmp levels are increased in bat forelimb digits relative to mouse forelimb and bat hind limb digits. (ac) phospho-histone H3 (Ser-10) Ab staining of proliferating cells in a stage-20 bat metacarpal (a), stage-20 bat metatarsal ...

Changing the Levels of BMP Can Alter Embryonic Bat Digit Length.

To test the ability of bat forelimb digits to respond to gain or loss of Bmp signaling, we cultured the bat embryonic handplate in control media or media supplemented with either Bmp2 or Noggin protein. Cultures containing Bmp2 caused a significant increase in metacarpal length compared with the contralateral bat forelimb cultured in control media (average increase, 239 μm; P = 0.003). Also, Bmp2 increased the relative proportion of the growth plate composed of the hypertrophic zone compared with controls (average increase, 16.9%; n = 10, P = 0.028). In contrast, Noggin treatment resulted in significantly shorter metacarpals (average decrease, 183 μm; P = 0.015) and a significantly smaller hypertrophic zone compared with controls (average decrease, 6.8%; n = 12, P = 0.046).

Bat Forelimb Digits Express Higher Levels of Bmp2 than the Digits of Either Bat Hind Limbs or Mouse Forelimbs.

To assess whether the bat exhibits a different pattern of Bmp expression relative to mouse, we performed immunofluorescence and semiquantitative RT-PCR to assay Bmp protein localization and gene-expression levels, respectively. In mice, Bmp2, Bmp4, and a known downstream component of Bmp signaling (phospho-Smad proteins 1/5/8) are expressed at moderate levels in the perichondrium of the metacarpals and metatarsals with weaker levels within the hypertrophic zone (Bmp2) and immediately adjacent areas (Bmp4) (1718) (Fig. 3 g and k). We detected no major differences in the general protein localization of Bmp2/4 and phospho-Smad in the bat forelimb metacarpals (Fig. 3 d, e, and i) and bat hindlimb metatarsals (Fig. 3 f and j) at stages 18, 19, 20, 21, or 22 or mouse forelimb metacarpals (Fig. 3 g and k) at E13.5, E14, E14.5, E15, and E15.5. Strikingly however, both Bmp and phospho-Smad proteins are more intense and continuous in the perichondrium of stage-20 bat forelimb metacarpals (Fig. 3 d, e, and i) than they are in the homologous elements of the bat hind limb (Fig. 3 f and j) or mouse forelimb (Fig. 3 g and k) of comparable stages. We confirmed this difference in expression level by semiquantitative RT-PCR performed on stage-20 bat and mouse metacarpals. By using 18S rRNA as a control, we found that Bmp2 expression is significantly higher (≈31%; P = 0.04) in bat metacarpals relative to mice (Fig. 3h). This increase was confirmed by using β-actin as an additional control (≈35% increase in Bmp2 expression in bat metacarpals). To determine whether this difference was specific to Bmp2, we also performed semiquantitative RT-PCR for Bmp4 and Bmp7. Our results with 18S rRNA and β-actin as controls indicate that Bmp4 and Bmp7 expression levels are not significantly increased in bats relative to mice (data not shown). Also, we examined the expression patterns of several genes that are known to be associated with the maturation of chondrocytes within the growth plate (i.e., Ihh, Pthrp, Fgfr1, Fgfr2, and ColX) by using RNA in situ hybridization, and we did not observe any notable differences between bat and mouse digits (data not shown). These data demonstrate a significant and specific increase in Bmp2 expression as well as phosphorylation of Smad proteins, the Bmp signal transducers, which also serve as a read-out of active Bmp signaling, in the bat forelimb digits.

Discussion

The great evolutionary success of bats can be attributed in large part to their achievement of powered flight. Bat powered flight is made possible by several key morphological innovations, one of the most crucial being the elongation of the forelimb digits (specifically, digits three, four, and five) to support the wing membrane. Our morphometric analyses indicate that the relative lengths of these bat digits have not significantly changed since the time when bats were first fossilized >50 million years ago. Therefore, little knowledge regarding one of the key morphological transitions in mammalian evolutionary history, that of the elongation of bat forelimb digits to support the wing membrane, can currently be gleaned from the fossil record.

Here, we used morphological and molecular techniques to uncover the developmental basis of the elongation of the digits of the bat forelimb. We find that the early embryonic bat digits (immediately after the formation of joints) are similar in size to those of mouse embryos of a comparable age. This finding suggests that the major developmental changes resulting in elongated bat forelimb digits occur after the early condensations and after segmentation relative to the ancestral, mouse-like pattern. This result therefore points to developmental changes in the regulation of longitudinal growth and differentiation within individual cartilage elements. Within bat and mouse all of the elements of the forelimb (i.e., phalanges, radius, ulna, and humerus) are similar in length at the time of segmentation. Thus, the similar length of the phalanges in bats and mice may be a result of a developmental constraint on skeletal development. In this respect, it could be that the segmentation program is set up to create skeletal primordia of similar size, thus forcing adaptive change in relative lengths to be controlled by subsequent postsegmental growth. Postsegmental longitudinal growth is controlled by the rates of chondrocyte proliferation and differentiation in the growth plate of the developing digits. We find that the region of the bat growth plate occupied by terminally differentiated chondrocytes, the hypertrophic zone, is greatly expanded in bats relative to mouse. Intriguingly, the increase in the relative size of the bat hypertrophic zone corresponds to the onset of the relative lengthening of the bat forelimb digits, suggesting a causative relationship between these two phenomena. In addition to the increase in size of the hypertrophic zone, the cartilage cells of bat forelimb digits also display higher rates of proliferation relative to those of either bat hind limbs or mouse forelimbs. Together, these findings suggest that increases in the extent of chondrocyte proliferation and differentiation are responsible for the remarkable elongation of bat forelimb digits during their development.

To understand the underlying molecular mechanisms by which proliferation and differentiation are affected in bat forelimb digits, we took a clue from studies in mice and rats. In mice, numerous Bmps (25 and 7) are expressed within the growth plate and perichondrium of the developing digits (17, 18). Also, mouse and rat digits that are cultured in the presence of Bmp2 protein grow longer than their controls, whereas digits that are cultured in the presence of Noggin (a known Bmp antagonist) are shorter (19, 20). Bmp2 protein affects these changes by stimulating both chondrocyte proliferation and initial hypertrophic differentiation and inhibiting terminal hypertrophic differentiation (19), a pattern that is strikingly similar to the pattern of cartilage differentiation observed in bat wing digits.

By using a similar limb-culture system, we demonstrate that the addition of Bmp2 protein can stimulate the further elongation of bat forelimb digits and increase the hypertrophic zone whereas the application of Noggin protein stunts their growth and decreases the hypertrophic zone. These results suggest that either an increase in Bmp expression or a decrease in the expression of Bmp antagonists such as Noggin could have driven the developmental elongation of bat forelimb digits. Although the spatial expression of Bmp2, Bmp4, and Bmp7 are similar in bats and mice, we found that there is a dramatic change in the level of Bmp2 expression in the bat forelimb digits. This result was confirmed by semiquantitative RT-PCR. Also, Bmp signaling is greatly increased in the bat forelimb digits relative to bat hind limb or mouse, as assayed by the phosphorylation of the Smad proteins, the Bmp signal transducers.

Together, our results indicate the up-regulation of the Bmp pathway as a major and fundamental (although not necessarily the only) mechanism responsible for the developmental elongation of bat forelimb digits. Based on our results, we raise the intriguing possibility that a similar up-regulation of the Bmp pathway had a role in the evolutionary elongation of bat forelimb digits, which is an event that was critical to the achievement of powered flight in bats. Recent studies (22, 23) have suggested that modifications to the cis-regulatory elements of developmental genes have central roles in the evolutionary diversification of morphology. Our evidence that Bmp2, but not Bmp4 or Bmp7, is differentially expressed in the bat wing digits is suggestive of a cis-regulatory change that affects the level, but not the temporal or spatial regulation, of Bmp2 expression. By linking a simple change in a single developmental pathway to dramatically different morphologies, we provide a potential explanation as to how bats were able to achieve powered flight soon after they diverged from other mammals nearly 65 million years ago (2, 9).

Materials and Methods

Adult Skeletal Morphometrics.

To evaluate the digit dimensions from fossil and modern bats, we performed a morphometric analysis. Measurement data of the lengths (distal to proximal and parallel to axis of the diaphysis) and widths (at the diaphysis midpoint) of all long bones of the forelimb and hindlimb (i.e., humerus, radius, ulna, femur, tibia, fibula, metacarpals, metatarsals, and phalanges) were obtained from osteological specimens of adult bats housed primarily at the Field Museum of Natural History (Chicago) (extant bats) and the American Museum of Natural History (AMNH; New York) (extinct bats), as well as from published photographs (8). In total, 10 extant and four extinct bat species were measured. The extant bats species span a broad phylogenetic range and were as follows: Rousettus egyptiacus, Glossophaga soricina, Nycteris macrotis, Rhinopoma hardwickei, Hipposideros commersoni, Pteronotus parnellii, Natalus stramineus, Balantiopteryx io, Eptesicus fuscus, and Tadarida brasiliensis. The extinct bat species are were as follows: Icaronycteris index (AMNH specimen nos. 125000 and 39501), Hipposideros sp. (AMNH specimen nos. 10019 and 10020), Archaeonycteris trigonodon [original Senckenburg Museum (Frankfurt) 80/1379; ref. 8], Paleochiropteryx tupaidodon (cast AMNH specimen no. 107679, original Senckenburg Museum Messel Fossil Locality 10; ref. 8). Measurements were taken three times and averaged to minimize the effect of measurement error. For extant bats, three specimens were measured and the results averaged. Measurements of <150 mm were taken with Mitutoyo absolute digimatic calipers, and measurements from 150 mm to 30 cm were taken with Fowler vernier calipers. Linear measurements were log-transformed before analysis to standardize their variances.

Linear regression analyses, with the lengths of the third, fourth, and fifth metacarpal as the dependent variables and PC1 (as a proxy for body size) as the independent variable, were performed to compare the relative lengths of the metacarpals of extinct and extant bats. Only the data from extant bats were used to generate regression lines. This approach allows for comparison of the observed digit lengths of extinct bats with the expected digit lengths of modern bats of a comparable size. PC1 was determined from a PC analysis (PCA) that was performed on the correlation matrix that was obtained by using the combined length and width data of all forelimb elements of these groups. PCA is a multivariate statistical technique that summarizes the variation that is present in a data set on a series of orthogonal axes, or PCs (24). PC1 summarizes most of the variation in the data, and as a result, it is commonly highly correlated with body size. If so, PC1 can be used as an appropriate proxy for regression analysis.

Embryos.

C. perspicillata makes an excellent model taxon because of its great abundance in the wild (25), the existence of procedures for maintaining and breeding it in the laboratory (26), and its recent use in several developmental studies (2729). C. perspicillata embryos were collected from wild-caught, pregnant females captured on Trinidad. Bat embryos were dissected, staged (30), and compared with WT C3H mouse embryos at a similar stage in development (mice were staged according to the Carnegie staging system).

Limb Cultures.

Bat metacarpals from embryos of various stages (1922) were stripped of skin and muscle and cultured for 4 days in BGJb medium (GIBCO/BRL), antibiotic/antimycotic (Life Technologies, Grand Island, NY), and 0.1% BSA at 37°C with 5% CO2 (19, 31). Cultures were supplemented with 500 ng/ml recombinant human Bmp2 (R & D Systems) or 500 ng/ml recombinant mouse Noggin protein (R & D Systems). The right limb from a given embryo was compared with the left limb from the same embryo that was cultured in unsupplemented media.

Tissue Processing.

For skeletal analysis, embryos at stages <20 were fixed overnight in Bouin's solution and stained for acidic glycosaminoglycans (cartilage) with Alcian blue; older embryos were fixed overnight in 4% paraformaldehyde and stained for cartilage and calcium (bone) with Alcian blue and Alizarin red, respectively. At least two bat and five mouse embryos from all stages 16–24 were examined. For histology, at least three bat and three mouse embryos from stages 18–22 were fixed overnight in 4% paraformaldehyde, and the limbs were embedded in paraffin, sectioned at 10 μm, stained in hematoxylin/eosin, and analyzed.

In situ hybridization was performed on embryos that were fixed overnight in 4% paraformaldehyde, embedded in paraffin, sectioned at 10 μm, and processed by using digoxigenin-labeled RNA probes. In all cases, mouse riboprobes with known functions in the mammalian growth plate (i.e., Ihh, Pthrp, and Bmp2, etc.) also recognized bat transcripts as shown by comparison of expression in various embryonic tissues. Immunohistochemistry and immunofluorescence were performed on frozen 10-μm sections with Abs against Bmp2/4 (Santa Cruz Biotechnology), phosphorylated Smad 1/5/8 (Cell Signaling Technology, Beverly, MA), and phosphorylated histone H3 (Ser-10) (Cell Signaling Technology). In the immunohistochemical experiments, hematoxylin was used as a counterstain. At least two bat and two mouse embryos from stages 18–22 were analyzed by immunofluorescence and in situ hybridization.

Semiquantitative RT-PCR.

To quantify Bmp2, Bmp4, and Bmp7 transcripts in bat and mouse, we performed two separate semiquantitative RT-PCR analyses, one analysis using 18S rRNA and the other analysis using β-actin RNA as a control. Metacarpals were dissected from comparably aged bat (stage 20) and mouse (E14.5, equivalent to Carnegie stage 20) embryos; samples from three bats and three mice were used. RNA was extracted (RNeasy kit; Qiagen, Valencia, CA), and cDNA was generated for each sample with the SuperScript III First-Strand Synthesis system for RT-PCR (Invitrogen).

To generate conserved primers for Bmp2, we first performed RT-PCR to amplify fragments of bat Bmp2 by using E90 bat testes mRNA (GenBank accession no. DQ279784). Degenerative primer sequences were obtained by aligning Bmp2 sequences from human (Homo), mouse (Mus), chick (Gallus), frog (Xenopus), and fish (Danio). The bat fragments were sequenced and aligned with mouse sequences to find conserved regions to generate the following primers (which span a 407-bp region) that are homologous to both bat and mouse: GCCTGCAGCAGCCAACTTG (sense) and CAGTCATTCCACCCCACATC (antisense). We followed the same procedure to generate conserved primers for Bmp4 (GenBank accession no. DQ279782) and Bmp7 (GenBank accession no. DQ279783). The conserved Bmp4 primers (which span a 429-bp region) are as follows: CTCATCACACGACTACTGGAC (sense) and GCAGTAGAAGGCCTGGTAGC (antisense). The conserved Bmp7 primers (which span a 410-bp region) are as follows: CAGGGCTTCTCCTACCCCTAC (sense) and TGACCACCCAGTGGTTGCTGG (antisense).

Semiquantitative RT-PCR using 18S rRNA as a control was performed with a QuantumRNA Universal 18S Internal Standard kit (the primers of which isolate a 315-bp fragment) according to the manufacturer's protocol (Ambion, Austin, TX) and a primer/competimer ratio of 2:8 and 42 PCR cycles.

To perform semiquantitative RT-PCR using β-actin RNA as a control, we generated conserved primers for β-actin (GenBank accession no. DQ279785) as described for Bmp2. The conserved primers homologous to both bat and mouse β-actin (spanning a 569-bp region) are as follows: CCATCCTGCGTCTGGACCTG (sense) and ACGATGGAGGGGCCGGACTC (antisense). Because β-actin is expressed at a much higher level than Bmp2 within metacarpal tissues, we used differing cycles (20 for β-actin and 55 for Bmp2) to be within the linear range. We used the following PCR conditions: 94°C for 20 sec, 55°C for 30 sec, and 72°C for 45 sec. PCR products were run on 1.5% agarose gels, and the resulting bands were quantified by using quantity one 1D analysis software (Bio-Rad). Significance of differences between bat and mouse levels were evaluated by using Mann–Whitney U tests (32).

Acknowledgments

We thank Chris Cretekos and Scott Weatherbee for field support and stimulating discussions; Jonathan Marcot and three anonymous reviewers for critical manuscript review; the collections staff of the Field Museum of Natural History and American Museum of Natural History; Simeon Williams, Dr. Indira Omah-Maharaj, and the Department of Life Sciences at the University of the West Indies (St. Augustine, Trinidad) for help with fieldwork in Trinidad; and the Wildlife Section, Forestry Division, Ministry of Agriculture, Land, and Marine Resources (currently in the Ministry of Public Utilities and the Environment) of the Republic of Trinidad and Tobago for the issuance of required collecting and export permits. This work was supported by National Research Service Award F32 HD050042-01 (to K.E.S.), National Science Foundation Grant IBN 0220458 (to R.R.B.), and National Institutes of Health Grant HD32427 (to L.A.N.). L.A.N. is an Investigator of the Howard Hughes Medical Institute.

Abbreviations

Bmp
bone morphogenetic protein
En
embryonic day n
PC
principal component.

Footnotes

Conflict of interest statement: No conflicts declared.

This paper was submitted directly (Track II) to the PNAS office. C.T. is a guest editor invited by the Editorial Board.

Data deposition: The sequences reported in this paper have been deposited in the GenBank database (accession nos. DQ279782DQ279785).

References

1. Nowak R. M. Walker's Bats of the World. Baltimore: Johns Hopkins Univ. Press; 1994.
2. Teeling E. C., Springer M. S., Madsen O., Bates P., O'Brien S. J., Murphy W. J. Science. 2005;307:580–584. [PubMed]
3. Teeling E. C., Scally M., Kao D. J., Romagnoli M. L., Springer M. S., Stanhope M. J. Nature. 2000;403:188–192. [PubMed]
4. Stanhope M. J., Czelusniak J., Si J. S., Nickerson J., Goodman M. Mol. Phylogenet. Evol. 1992;1:148–160. [PubMed]
5. Springer M. S., Stanhope M. J., Madsen O., de Jong W. W. Trends Ecol. Evol. 2004;19:430–438. [PubMed]
6. Thewissen J. G. M., Babcock S. K. Bioscience. 1992;42:340–345.
7. Speakman J. R. Mamm. Rev. 2001;31:111–130.
8. Simmons N. B., Geisler J. H. Bull. Am. Mus. Nat. Hist. 1998;235:4–182.
9. Cao Y., Fujiwara M., Nikaido M., Okada N., Hasegawa M. Gene. 2000;259:149–158. [PubMed]
10. Valentine J. W., Jablonski D., Erwin D. H. Development (Cambridge, U.K.) 1999;126:851–859. [PubMed]
11. Rutherford S. L., Lindquist S. Nature. 1998;396:336–342. [PubMed]
12. Jernvall J. Proc. Natl. Acad. Sci. USA. 2000;97:2641–2645. [PMC free article] [PubMed]
13. Cohn M. J., Tickle C. Nature. 1999;399:474–479. [PubMed]
14. Fondon J. W., Garner H. R. Proc. Natl. Acad. Sci. USA. 2004;101:18058–18063. [PMC free article] [PubMed]
15. Abzhanov A., Protas M., Grant B. R., Grant P. R., Tabin C. J. Science. 2004;305:1462–1465. [PubMed]
16. Ballock R. T., O'Keefe R. J. J. Bone Joint Surg. 2003;85A:715–726. [PubMed]
17. Yoon B. S., Lyons K. M. J. Cell. Biochem. 2004;93:93–103. [PubMed]
18. Solloway M. J., Dudley A. T., Bikoff E. K., Lyons K. M., Hogan B. L. M., Robertson E. J. Dev. Genet. 1998;22:321–339. [PubMed]
19. Minina E., Wenzel H., Kreschel C., Karp S., Gaffield W., McMahon A., Vortkamp A. Development (Cambridge, U.K.) 2001;128:4523–4534. [PubMed]
20. De Luca F., Barnes K. M., Uyeda J. A., De-Levi S., Abad V., Palese T., Mericq V., Baron J. Endocrinology. 2001;142:430–436. [PubMed]
21. Niswander L. Nat. Rev. Genet. 2003;4:133–143. [PubMed]
22. Gompel N., Prud'homme B., Wittkopp P. J., Kassner V. A., Carroll S. B. Nature. 2005;433:481–487. [PubMed]
23. Shapiro M. D., Marks M. E., Peichel C. L., Blackman B. K., Nereng K. S., Jonsson B., Schluter D., Kingsley D. M. Nature. 2004;428:717–723. [PubMed]
24. Reyment R., Joreskog K. G. Applied Factor Analysis in the Natural Sciences. Cambridge, U.K.: Cambridge Univ. Press; 1993.
25. Fleming T. H. The Short-Tailed Fruit Bat. Chicago: Univ. of Chicago Press; 1988.
26. Rasweiler J. J., IV, Badwaik N. K. Lab. Anim. Sci. 1996;2:171–181. [PubMed]
27. Evarts J. L., Rasweiler J. J., IV, Behringer R. R., Hennighausen L., Robinson G. W. Biol. Reprod. 2004;70:1573–1579. [PubMed]
28. Cretekos C. J., Rasweiler J. J., IV, Behringer R. R. Reprod. Fertil. Dev. 2001;13:691–695. [PubMed]
29. Chen C. H., Cretekos C. J., Rasweiler J. J., IV, Behringer R. R. Evol. Dev. 2005;7:130–141. [PubMed]
30. Cretekos C. J., Weatherbee S. D., Chen C. H., Badwaik N. K., Niswander L., Behringer R. R., Rasweiler J. J., IV Dev. Dyn. 1996;233:721–728. [PubMed]
31. Vortkamp A., Lee K., Lanske B., Segre G. V., Kronenberg H. M., Tabin C. J. Science. 1996;273:613–622. [PubMed]
32. Sokal R. R., Rohlf F. J. Biometry. New York: Freeman; 1995.

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...