Logo of embojLink to Publisher's site
EMBO J. Feb 3, 2003; 22(3): 612–620.
PMCID: PMC140732

Molecular evidence for a positive role of Spt4 in transcription elongation

Abstract

We have previously shown that yeast mutants of the THO complex have a defect in gene expression, observed as an impairment of lacZ transcription. Here we analyze the ability of mutants of different transcription elongation factors to transcribe lacZ. We found that spt4Δ, like THO mutants, impaired transcription of lacZ and of long and GC-rich DNA sequences fused to the GAL1 promoter. Using a newly developed in vitro transcription elongation assay, we show that Spt4 is required in elongation. There is a functional interaction between Spt4 and THO, detected by the lethality or strong gene expression defect and hyper-recombination phenotypes of double mutants in the W303 genetic background. Our results indicate that Spt4–Spt5 has a positive role in transcription elongation and suggest that Spt4–Spt5 and THO act at different steps during mRNA biogenesis.

Keywords: lacZ/SPT4/SPT5/THO complex/transcription elongation

Introduction

Transcription is a complex cellular process that involves three differentiated steps: initiation, elongation and termination. During elongation, RNA polymerase II (RNAPII) has to overcome situations derived from transient pausing caused by regulatory signals. This is achieved with the help of positive and negative transcriptional elongation factors. Positive factors include TFIIS (Wind and Reines, 2000), TFIIF (Bengal et al., 1991), human Elongin (Aso et al., 1995), ELL (Shilatifard et al., 1996), FACT (LeRoy et al., 1998; Orphanides et al., 1998; Wada et al., 2000), Elongator (Otero et al., 1999; Wittschieben et al., 1999), CSB/Rad26 (van Gool et al., 1997) and the 19S regulatory particle of the proteasome (Ferdous et al., 2001). Negative elongation factors include DSIF and NELF (Hartzog et al., 1998; Wada et al., 1998a; Yamaguchi et al., 1999a, 2002).

DSIF was isolated from HeLa cell nuclear extracts as a transcription elongation factor that causes pausing of RNAPII when cells are treated with 5,6-dichloro-1-β-d-ribofuranosylbenzimidazole (DRB) (Wada et al., 1998a; Yamaguchi et al., 1999b). It is formed by two subunits, which are the human homologs of the Saccharomyces cerevisiae transcription factors Spt4 and Spt5 (Wada et al., 1998a; Yamaguchi et al., 1999b). Consistent with the role of Spt4–Spt5/DSIF in transcription elongation, Drosophila Spt5 has been shown to colocalize with RNAPII at highly transcribed sites of polytene chromosomes and at heat-shock genes upon induction (Andrulis et al., 2000; Kaplan et al., 2000). Also, Drosophila and yeast Spt5 proteins are bound to open reading frames (ORFs) when they are transcriptionally active, as determined by chromatin immunoprecipitation (ChIP) analysis (Andrulis et al., 2000; Pokholok et al., 2002). Furthermore, yeast Spt4 and Spt5 are tightly associated in a protein complex that interacts with RNAPII (Hartzog et al., 1998).

In vitro studies indicate that DSIF acts as a negative elongation factor, increasing the pausing of RNAPII (Yamaguchi et al., 1999b; Renner et al., 2001). The pausing is reversed by P-TEFb, which phosphorylates the RNAPII CTD and the DSIF hSpt5 subunit (Wada et al., 1998b; Kim and Sharp, 2001; Renner et al., 2001). Spt4–Spt5/DSIF complex has also been suggested to have a positive role in transcription elongation, although this has not been demonstrated yet. Thus, spt4Δ mutants are sensitive to 6-azauracil (6-AU; Hartzog et al., 1998; Costa and Arndt, 2000), a phenotypic landmark of transcription elongation defects caused by the in vivo depletion of GTP and UTP pools provoked by 6-AU (Shaw and Reines, 2000). In addition, it has been shown that S.cerevisiae spt5-194 mutation causes a decrease in the levels of some RNAPII transcripts (Compagnone-Post and Osley, 1996) and that purified human DSIF stimulates transcription under limiting NTP concentrations (Wada et al., 1998a) or when added in excess to isolated early elongation complexes (Renner et al., 2001).

THO was identified in yeast as a four-protein complex that included Tho2, Hpr1, Mft1 and Thp2 (Chávez et al., 2000). Previous genetic and functional evidence indicated that mutations in the THO complex caused a strong transcription-dependent hyper-recombination phenotype and a defect in gene expression (Chávez and Aguilera, 1997; Piruat and Aguilera, 1998; Chávez et al., 2001). THO mutants, such as hpr1, are preferentially affected in their ability to express long and GC-rich DNA sequences driven from a strong promoter, as is the case of lacZ fused to the GAL1 promoter (Chávez et al., 2001). It has recently been shown that THO is present, together with the components of the mRNA export machinery Sub2 and Yra1, in a larger complex conserved in yeast and humans, termed TREX. This complex is associated with ORFs in a transcription-dependent manner (Strässer et al., 2002). THO and mRNA-export mutants show, indeed, similar defects in transcription suggesting a connection between both transcription and mRNA metabolism (Jimeno et al., 2002). Our actual view is that THO has a major role in the metabolism of nascent mRNA during transcription, suggesting that the status of the nascent RNA becomes important for proper transcription (Jimeno et al., 2002).

In this study, we developed a new in vitro assay for the analysis of transcription elongation in whole-cell extracts (WCEs). With this assay, we showed that Spt4 is strongly required for transcription elongation. In addition, we found that spt4Δ mutants are strongly impaired in transcription of lacZ and other long and GC-rich DNA sequences driven from a strong promoter, phenotypes observed previously for the mutants of the THO complex. In contrast to THO mutations, spt4 does not confer a transcription-dependent hyper-recombination phenotype. In the W303 genetic background, double mutant strains carrying spt4Δ and a THO mutation are either inviable or show stronger transcription and recombination phenotypes than the single mutants. We conclude that Spt4 has a positive role in transcription elongation and that this role is different from that of THO during mRNA biogenesis.

Results

Analysis of gene expression in different transcription elongation mutants: impairment of lacZ expression in spt4 and spt5

Mutants of the THO complex are defective in lacZ gene expression (Chávez et al., 2000). In order to establish whether the incapacity to express lacZ could be used as a phenotype linked to transcription elongation defects, we determined the ability of a number of known transcription elongation mutants to transcribe lacZ. We performed northern analysis of mutants and their respective wild-type isogenic strains transformed with centromeric plasmid pSCh204 (Chávez and Aguilera, 1997), in which the complete lacZ ORF is located between two truncated copies of LEU2 transcribed from the LEU2 promoter, yielding a 4.5 kb transcript. Figure 1 shows that the spt4-3 mutant had a dramatic effect on the level of lacZ mRNA; reduced to 7% of the level of a wild-type strain. Among the other mutants tested (ela1Δ, elp1Δ, elp2Δ, elp3Δ, spt6-140, spt16-197, rpb2-10, dst1 and rpb2-10 dst1), lacZ mRNA levels were slightly reduced in elp3Δ (30% of the wild-type levels), spt6-140 and rpb2-10 mutants (50% the wild-type levels) and was not affected in the rest of the mutants.

figure cdg047f1
Fig. 1. Transcription analysis of a leu2Δ3::lacZ fusion in different transcription elongation mutants and their respective isogenic wild-type strains. Northern analyses were performed from overnight cultures of yeast cells transformed ...

Spt4 forms a complex with Spt5 that is homologous to the human DSIF complex. Whereas Spt5 is essential for cell viability, Spt4 is not. For this reason, we decided to extend our functional analysis of lacZ transcription to null spt4Δ mutants. In this case, we analyzed gene expression in the Ptet::lacZ-URA3 translational fusion (Jimeno et al., 2002). We have shown previously that mutants with an impaired ability to express lacZ, such as the mutants of the THO complex, are incapable of expressing this fusion. They yield a Ura phenotype and white colonies in X-gal-containing medium in contrast to the Ura+ phenotype and blue-color forming colonies of wild-type cells (Jimeno et al., 2002). As expected, spt4Δ cells carrying Ptet::lacZ-URA3 are Ura and they do not form blue-color colonies when adding X-gal to the medium (data not shown). They showed lacZ mRNA levels that were 20% of the wild type, confirming that spt4Δ cells are impaired in expression of lacZ driven from a Ptet promoter (Figure 2B). Next, we determined whether the leaky mutations spt5-194 and spt5-242 also conferred a defect in lacZ transcription. As can be seen in Figure 2B, both alleles reduced the efficiency of transcription of Ptet::lacZ-URA3 to levels in the range of those of spt4Δ. As spt4 and spt5 have similar transcription phenotypes, we decided to continue our analysis with the spt4Δ null mutant only.

figure cdg047f2
Fig. 2. Transcription analysis of lacZ in wild-type, spt4Δ and spt5 mutant cells. (A) Scheme of the lacZ-URA3 translational fusion under the control of the tet promoter. (B) Northern analyses of lacZ-URA3 expression in wild-type ...

spt4Δ cells have a strongly reduced capacity to express lacZ and long and GC-rich DNA sequences fused to the GAL1 promoter

Using a GAL1p::lacZ fusion, we showed, by kinetic analysis of transcription activation, that spt4Δ cells show low levels of accumulation of lacZ mRNA for 170 min after activation by galactose addition (Figure 3). The low mRNA levels are not due to a defect in activation of the GAL1 promoter, but rather to an incapacity to properly transcribe lacZ. When an identical experiment was performed with a GAL1p::PHO5 fusion, in which the bacterial lacZ sequence was replaced by the yeast PHO5 sequence, accumulation of PHO5 mRNA occurred with the same kinetics as the wild type, reaching similar wild-type levels of transcription after 170 min of galactose addition (Figure 3). This result demonstrates that it is the transcription through lacZ, and not the activation of the GAL1 promoter, that is impaired in spt4Δ cells.

figure cdg047f3
Fig. 3. Transcription analysis of GAL1p::lacZ, GAL1p::PHO5, GAL1p::klLAC4, GAL1p::LYS2 and GAL1p::YAT1 in wild-type and spt4Δ cells. Northern analyses of lacZ, PHO5, klLAC4, LYS2 and YAT1 mRNAs driven from the GAL1 promoter in the strains BY4741 ...

So far spt4Δ mutants have shown identical transcription defects to those described previously for mutants of the THO complex. In addition, the bacterial lacZ ORF is a 3 kb long sequence with a 56% GC content, whereas PHO5 is a 1.5 kb long DNA sequence with a 40% GC content. We showed that lacZ sequences were not properly transcribed in an hpr1Δ mutant because these mutants were impaired in their ability to express long and GC-rich DNA sequences fused to the GAL1 promoter (Chávez et al., 2001). Consequently, in order to determine whether the inability of spt4Δ cells to express lacZ reflects their incapacity to properly express long and GC-rich DNA sequences, we extended the kinetic analysis of transcription activation of spt4Δ cells to the following three fusion constructs: GAL1p::klLAC4, GAL1p::LYS2 and GAL1p:: YAT1. The klLAC4 sequence was a 3 kb long ORF from the yeast Kluyveromyces lactis, homologous to lacZ but with a typical yeast GC content (40%). LYS2 was a 3.5 kb long S.cerevisiae DNA sequence with a standard yeast GC content (40%). YAT1 was a 2 kb long S.cerevisiae ORF with an unusually high GC-content (58%). Kinetics of transcription activation of GAL1p::klLAC4 showed that transcription was also impaired in this construct (Figure 3), presumably due to the fact that klLAC4 was a long ORF (3 kb). However, in contrast to bacterial lacZ (56% GC content), significant levels of klLAC4 transcript were accumulated after 170 min of galactose addition. Therefore, lowering the GC content of a 3 kb long ORF facilitated its transcription in spt4Δ cells. Figure 3 shows that spt4Δ cells accumulated almost undetectable levels of mRNA from either the GAL1p::LYS2 or the GAL1p::YAT1 constructs after 170 min of transcription activation by galactose addition. However, spt4Δ cells did accumulate PHO5 mRNA (1.5 kb long with 40% GC content) like wild-type cells. Therefore, these results are consistent with the idea that Spt4 is required for proper transcription of long and GC-rich DNA sequences driven from the GAL1 promoter.

Defective transcription elongation in spt4Δ WCEs

Our functional analysis of transcription in spt4-3 and spt4Δ cells indicates that Spt4 may have a positive role in transcription elongation. In order to test this possibility directly, we assayed the ability of spt4Δ WCEs to promote transcription elongation in vitro. To accomplish this, we developed an in vitro transcription system based on plasmid pGCYC1-402 in which a hybrid GAL4-CYC1 promoter containing a Gal4-binding site was fused to a 1.88 kb DNA fragment coding two G-less cassettes separated by 1.4 kb. The first G-less cassette was right downstream of the promoter and it was 84 nucleotides (nt) long. The second one was located at 1.48 kb from the promoter and was 376 nt long. In this assay, transcription activated by Gal4-VP16 led to an mRNA, which was then digested with RNase T1, an RNase that degrades all G-containing mRNA sequences, leaving the two G-less cassettes intact (Figure 4A and B). The efficiency of transcription elongation was determined as the percentage of all mRNAs reaching the 376 nt long G-less cassette among the total mRNA covering the 87 nt long G-less cassette (Figure 4C). As can be seen in Figure 4C, after Gal4-VP16 activation, spt4Δ cell extracts fully transcribed the 376 nt G-less cassette with a clearly reduced efficiency with respect to the wild type, as determined by kinetic analysis of transcription elongation. This is the first molecular demonstration that Spt4 has a positive role in transcription elongation.

figure cdg047f4
Fig. 4. In vitro transcription assays of wild-type and spt4Δ WCEs. (A) Scheme of double-G-less cassette system. RNase T1-treatment of mRNA driven from GAL4-CYC1 promoter render two fragments corresponding to the G-less cassettes. (B ...

Genetic interaction between Spt4 and the THO complex

Considering the similarity of in vivo transcription phenotypes conferred by spt4Δ and by the mutations of the THO complex, we decided to investigate whether there was a genetic relationship between these mutations by performing genetic analyses of double mutant combinations. With this purpose, we crossed a spt4Δ strain with single mutants of the THO complex (tho2Δ, hpr1Δ and mft1Δ) and performed tetrad analysis. Figure 5 shows that tho2Δ spt4Δ and hpr1Δ spt4Δ double mutants were inviable (hpr1Δ spt4Δ divided 5–10 times after germination). We show that the inviability of spt4Δ hpr1Δ mutants is, indeed, rescued by HPR1 carried in a plasmid. The mft1Δ spt4Δ double mutant was viable but sick; it grew poorly compared with single mutants (Figure 5). However, this result was dependent on genetic background. When we repeated the same experiments in the BY4741 instead of the W303 genetic background, we found that double mutants were viable. This result is consistent with our previous observation that Tho2 and Hpr1 are the most prominent components of the THO complex (Chávez et al., 2000).

figure cdg047f5
Fig. 5. Genetic analysis of the growth phenotype conferred by spt4Δ in combination with mutations of the THO complex. Tetrad analyses of the diploid strains obtained by crossing spt4Δ strain with either tho2Δ, hpr1Δ and ...

As the most relevant features of the THO mutants were the transcription, hyper-recombination and plasmid-loss phenotypes, we took advantage of the viability of mft1Δ spt4Δ cells in the isogenic W303 genetic background to explore further the functional relationship between Spt4 and THO by analyzing these three phenotypes. We analyzed the effect on transcription by determining the kinetics of activation of the endogenous GAL1 gene. As can be seen in Figure 6, both wild-type and mft1Δ cells had almost no effect on the kinetics of activation of GAL1. However, spt4Δ cells clearly showed slower kinetics of activation of GAL1 mRNA accumulation, whereas the mft1Δ spt4Δ double mutant showed about half that of spt4Δ.

figure cdg047f6
Fig. 6. Transcription analysis of GAL1 in spt4Δ mft1Δ cells. Northern blot analyses of GAL1 mRNA in the strains W303-1A (WT), MGSC339 (spt4Δ), WMS-1C (mft1Δ) and WMS-7C (spt4Δ mft1Δ). DNA probes used were ...

For the analysis of recombination, we first observed that spt4Δ had wild-type levels of recombination in the chromosomal direct-repeat construct leu2-k::ADE2-URA3::leu2-k (data not shown), a system in which mft1Δ and other mutations of the THO complex conferred an increase in deletions two orders of magnitude above wild-type levels (Piruat and Aguilera, 1998). We then analyzed recombination in the direct-repeat construct leu2Δ3:: ADE2::leu2Δ5′ in centromeric plasmid pRS314-LA (Prado et al., 1997). As can be seen in Figure 7A, mft1Δ and spt4Δ single mutants showed 4- and 6-fold increases in recombination, respectively, whereas the mft1Δ spt4Δ double mutant showed a 25-fold increase.

figure cdg047f7
Fig. 7. Recombination and plasmid instability analyses in wild-type, mft1Δ, spt4Δ and spt4Δ mft1Δ cells. (A) Scheme of the deletion resulting from a recombination event between the direct repeats. Transcripts driven ...

Plasmid stability was analyzed for centromeric plasmid pRS313GZ containing the GAL4-CYC1p::lacZ fusion and the HIS3 marker. As shown in Figure 7B, when transcription of lacZ was inactive, mft1Δ reduced the stability of the plasmid 3.7-fold below wild-type levels, spt4Δ 1.3-fold and the double mutant 13.5-fold. When transcription of lacZ was active, the reduction was 82-fold for mft1Δ cells, 0.6-fold in spt4Δ and 245-fold in the mft1Δ spt4Δ double mutant as compared with the wild type.

Discussion

We have shown that Spt4 has a positive role in transcription elongation. The ability of spt4Δ cell extracts to elongate transcription in vitro is clearly reduced with respect to the wild type. Furthermore, spt4 and spt5 cells are impaired in transcription of lacZ and other long and GC-rich DNA sequences driven from the GAL1 promoter. There is a genetic interaction between Spt4 and THO, detected in the W303 genetic background by the lethality of tho2Δ spt4Δ and hpr1Δ spt4Δ double mutants, and by a stronger transcription and hyper-recombination phenotypes of the mft1Δ spt4Δ double mutant. These results are consistent with the idea that Spt4–Spt5 has a positive role in transcription elongation and that Spt4 and THO act at different levels during mRNA biogenesis.

Spt4 forms, together with Spt5, the yeast homolog of DSIF, a human factor whose negative role in transcription elongation has been well documented. In vitro it is required, together with NELF, for RNAPII pausing (Wada et al., 1998a; Yamaguchi et al., 1999a; Renner et al., 2001). DSIF has been found tightly bound to hypo-phosphorylated RNAPII in HeLa nuclear extracts (Wada et al., 1998a; Yamaguchi et al., 1999b) as well as to hyper-phosphorylated RNAPII (Lindstrom and Hartzog, 2001). Consistent with a negative role at the early steps of transcription elongation, DSIF has been shown to inhibit only hypo-phosphorylated RNAPII (Yamaguchi et al., 1999a). It has been suggested that DSIF dissociates from RNAPII upon CTD phosphorylation by P-TEFb (Wada et al., 1998b). However, there are data suggesting that Spt4–Spt5/DSIF may have a positive role in elongation also. These data include the 6-AU sensitivity of yeast spt4Δ mutants (Hartzog et al., 1998; Costa and Arndt, 2000) and the stimulation of in vitro transcription by DSIF or under limiting NTPs (Wada et al., 1998a) or when purified DSIF was added in excess to early elongation complexes (Renner et al., 2001). Here we demonstrate, with a newly developed in vitro transcription assay, that Spt4 plays a positive role in transcription elongation. The spt4Δ null mutation reduces the efficiency of elongation at least 4-fold below wild-type levels (Figure 4). This result is consistent with our observation that spt4Δ cells are impaired in their ability to transcribe lacZ in vivo, regardless of the promoter from which transcription is driven, or in their ability to transcribe long and GC-rich DNA sequences (Figures 2 and and3).3). The spt5-194 and spt5-242 alleles reduced the efficiency of transcription of Ptet::lacZ-URA3 to levels similar to those of spt4Δ (Figure 2B). This positive role in transcription elongation is consistent with recent data showing that in an HIV-Tat based system, Spt5, in cooperation with Tat, prevents the premature dissociation of RNA from the transcription complex at terminator sequences and reduces the amount of RNAPII pausing at arrest sites (Bourgeois et al., 2002). This function resembles that of bacterial NusG, which contacts and enhances RNA polymerase stability on DNA templates (Li et al., 1992; Sullivan and Gottesman, 1992) and has a region homologous to Spt5 (Hartzog et al., 1998; Wada et al., 1998a; Ponting, 2002).

Mutants of the THO complex, such as hpr1 and tho2, show a similar incapacity to express long and GC-rich DNA sequences fused to the GAL1 promoter (Chávez et al., 2001). Indeed, it has recently been shown by ChIP analysis that Spt5 and Tho2/Hpr1 associate with transcriptionally active ORFs (Andrulis et al., 2000; Pokholok et al., 2002; Strässer et al., 2002). These results suggest that both Spt4–Spt5/DSIF and THO act during transcription. This is consistent with the isolation of Hpr1 and Spt4–Spt5 in combination with components of the Paf1–Cdc73 complex associated with RNAPII (Chang et al., 1999; Squazzo et al., 2002).

It is important to note that THO is associated with the mRNA export proteins Sub2 and Yra1 in a larger complex (Strässer et al., 2002), that THO associates with RNA and that THO mutants accumulates mRNA in the nucleus (Strässer et al., 2002; Jimeno et al., 2002). This, together with the synthetic lethality of double mutants of THO and Mex67, indicates that THO may function at the level of the nascent mRNA. However, in contrast to THO mutants, spt4 cells do not accumulate mRNA in the nucleus (data not shown) and, in contrast to tho2 mex67-5 mutants, spt4 mex67-5 double mutants are viable (S.Jimeno and A.Aguilera, unpublished data). The synthetic lethality of hpr1 spt4 and tho2 spt4, the high genetic instability phenotype of mft1Δ spt4Δ (Figure 7) and the fact that the observed hyper-recombination in spt4Δ cells is not linked to transcription (data not shown; Malagón and Aguilera, 1996) suggests that THO and Spt4 act at different levels.

A distinctive feature of lacZ with respect to yeast ORFs such as GAL1, through which transcription is either poorly or not affected in hpr1Δ, is a lack of nucleosome positioning (Chávez et al., 2001). It is possible that the Spt4–Spt5 function was more acute during transcription of DNA sequences with a poorly organized chromatin. However, it is important to note that the positive role of Spt4 in transcription elongation is observed in vitro with naked DNA (Figure 4). This indicates that the major function of Spt4 in elongation is independent of chromatin structure. Nevertheless, we cannot discard that, in addition, Spt4 might have in vivo a positive role in transcription elongation related to chromatin structure (see Winston and Carlson, 1992). In this sense, it is worth mentioning that spt4Δ strains transcribe a HTA1-lacZ fusion with an efficiency 5-fold below wild-type levels, a defect that is suppressed by overexpression of histones H2A and H2B (Compagnone-Post and Osley, 1996). This may be due to a defect in the regulation and feedback repression of histone genes in spt4 mutants (Compagnone-Post and Osley, 1996), but it could also be due to the inefficient lacZ transcription of spt4 mutants or to the effect that histone imbalance may cause on the nucleosome assembly. In any case, since imbalance of histone stoichiometry alters transcription of a number of yeast genes (Wyrick et al., 1999), we cannot disregard that phenotypes associated with histone imbalance are due to the secondary effect on transcription regulation of other genes.

We believe that Spt4 acts upstream of the THO complex during transcription as a bona fide transcription elongation factor. The THO complex might act downstream of Spt4–Spt5 in association with the nascent mRNA and other proteins whose specific functions are related to mRNA metabolism (Strässer et al., 2002; Jimeno et al., 2002). It is likely that the effect of THO mutations in transcription is mediated by a possible role in the stabilization or processing of the nascent mRNA (Jimeno et al., 2002). We need to understand better the molecular basis of the requirement of Spt4–Spt5 for expression of DNA sequences such as lacZ in order to decipher why the effect of Spt4–Spt5 on lacZ expression differs from those of other putative elongation factors (Figure 1). However, our novel in vitro transcription analysis demonstrates for the first time that Spt4–Spt5 plays a positive role in transcription elongation, which might explain the lacZ expression defects of spt4 and spt5 cells.

Materials and methods

Yeast strains and plasmids

Yeast strains used are listed in Table I. Plasmids used for expression analyses were p416GAL1lacZ (Mumberg et al., 1994), pSCh202 and pSCh204 (Chávez and Aguilera, 1997), pSCh255, pSCh227 and pSCh247 (Chávez et al., 2001). pRS314-LA (Prado et al., 1997) and pRS313GZ (P.Huertas, unpublished data) were used to determine recombination frequencies and plasmid stability, respectively. The latter plasmid contains the lacZ fusion under GAL4-CYC1 hybrid promoter cloned in vivo from pSEZT (J.Svejstrup, Cancer Research UK, South Mimms, UK) into pRS313 (Sikorski and Hieter, 1989) as described previously (Prado and Aguilera, 1994). YEpHPR1 used to rescue hpr1Δ spt4Δ derives from YEp13. Plasmid pRJRGAL4-VP16 (M.Ptashne, Sloan-Kettering Institute, New York, NY) was used to purify the His6-tagged Gal4-VP16 recombinant protein from E.coli. For in vitro transcription, we constructed plasmid pGCYC1-402, which contains double-G-less cassettes of 84 and 376 bp separated by 1.4 kb fused to a GAL4-CYC1 hybrid promoter. For the construction of this plasmid, the 300 bp GAL4-CYC1 promoter was obtained by PCR from pGAL4CG (Lue et al., 1989) using primers CTAGAGGATCCGGGTGACAGCCCTCCG and CGA TACATCGATAGGAGACTAGGGTGGTATAG and cloned into the SmaI site of pBSK+ to give pGCYC1. The new plasmid was then used to clone at the ClaI site generated at the 3′-end of the promoter, the double-G-less cassette system obtained by PCR from pSLG402 (Lee and Greenleaf, 1997) using primers CATGAAATCGATGGGTGTTCCTGAAGGGGGGC and GCAGGCCTAATCGATTCTAGAGGATCCCCG.

Table I.
Strains

In vivo analysis of gene expression

Ten micrograms of total RNA was prepared from induced cultures and used for northern analysis following standard procedures (Chávez and Aguilera, 1997). DNA filters were hybridized first with 32P-labelled DNA probes as specified. For determination of the total amount of RNA used, filters were stripped and re-hybridized with 32P-labelled 28S rDNA obtained by PCR as described previously (Chávez and Aguilera, 1997).

Frequency of recombination and plasmid stability

For the determination of the recombination frequencies, six independent colonies were obtained from SC-trp and recombinants were scored as Leu+ colonies on SC-trp-leu. Recombination frequencies were calculated as the median frequency of six independent cultures as described previously (Prado and Aguilera, 1995). Plasmid stability was determined as the median frequency of plasmid-containing cells (His+ colonies) from a total of six independent colonies isolated from non-selective synthetic complete medium, as described previously (Piruat and Aguilera, 1998). Each recombination frequency value represents the mean of two independent experiments.

Preparation of yeast WCEs

Yeast cells were grown in rich medium YEPD at 30°C to an OD600 of 1. WCEs were prepared essentially as described in Schultz et al. (1991), with the exception that the extraction buffer and precipitation and dialysis were performed as described by Woontner et al. (1991). Protein concentrations were determined according to Bradford (1976) using bovine serum albumin as standard. The final protein concentrations of the WCEs varied from 30 to 40 mg/ml. WCEs were distributed in aliquots and stored in liquid nitrogen. They were stable after repeated cycles of freezing and thawing.

In vitro transcription

Each reaction was performed in a final volume of 20 µl of buffer A 0.5 (20 mM HEPES pH 7.5, 20% glycerol, 1 mM EDTA, 1 mM DTT and 500 mM KAc) with 100 µg of WCE (3 µl) and 100 ng of Gal4-VP16 purified as described by Cho et al. (1997) and dialyzed in buffer A 0.05 (as A 0.5 but with 50 mM KAc). Final KAc concentration should be lower than 150 mM. The reaction was set up adding 20 µl of transcription buffer 2× [final concentration: 40 mM HEPES–KOH pH 7.5, 5 mM MgCl2, 1 mM ATP, 1 mM GTP, 0.5 mM UTP, 0.03 mM CTP, 40 mM phosphocreatine, 32 µg of creatine kinase (CK), 5 mM dithiothreitol and 7.5 U of the RNase inhibitor RNAguard (Amersham)]. After 20 min of pre-incubation at room temperature 400 ng of pGCYC402 and 1 µl [α-32P]CTP (3000 Ci/mmol) were added. The reaction was stopped at the indicated times by addition of 200 µl of stop buffer (10 mM Tris–HCl pH7.5, 0.3 M NaCl and 5 mM EDTA) and 160 U RNaseT1 for 15 min at room temperature. Samples were treated with proteinase K, phenol-extracted and run in a sequencing gel as described in Sayre et al. (1992). The amount of radiactivity incorporated was quantified with a Fuji FLA3000.

Miscellaneous

DNA isolation, 32P-radiolabeling, genetic crosses and yeast transformations were performed according to standard procedures (Prado and Aguilera, 1995).

Acknowledgements

We would like to thank J.Svejstrup, J.Brouwer, D.Reines, F.Winston, G.Hartzog and M.Ptashne for yeast strain or plasmid gifts, F.Prado and S.Jimeno for comments on the manuscript and D.Haun for style supervision. Research was funded by grants from the Spanish Ministry of Science and Technology (BMC2000-0439) and the Human Frontier Science Program (RG1999/0075). A.G.R. and S.G.-B. were recipients of pre-doctoral training grants from the Spanish Ministry of Education and Culture.

References

  • Andrulis E.D., Guzman,E., Doring,P., Werner,J. and Lis,J.T. (2000) High-resolution localization of Drosophila Spt5 and Spt6 at heat shock genes in vivo: roles in promoter proximal pausing and transcription elongation. Genes Dev., 14, 2635–2649. [PMC free article] [PubMed]
  • Aso T., Lane,W.S., Conaway,J.W. and Conaway,R.C. (1995) Elongin (SIII): a multisubunit regulator of elongation by RNA polymerase II. Science, 269, 1439–1443. [PubMed]
  • Bengal E., Flores,O., Krauskopf,A., Reinberg,D. and Aloni,Y. (1991) Role of the mammalian transcription factors IIF, IIS and IIX during elongation by RNA polymerase II. Mol. Cell. Biol., 11, 1195–1206. [PMC free article] [PubMed]
  • Bourgeois C.F., Kim,Y.K., Churcher,M.J., West,M.J. and Karn,J. (2002) Spt5 cooperates with human immunodeficiency virus type 1 tat by preventing premature RNA release at terminator sequences. Mol. Cell. Biol., 22, 1079–1093. [PMC free article] [PubMed]
  • Bradford M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem., 72, 248–254. [PubMed]
  • Chang M., French-Cornay,D., Fan,H.Y., Klein,H., Denis,C.L. and Jaehning,J.A. (1999) A complex containing RNA polymerase II, Paf1p, Cdc73p, Hpr1p and Ccr4p plays a role in protein kinase C signaling. Mol. Cell. Biol., 19, 1056–1067. [PMC free article] [PubMed]
  • Chávez S. and Aguilera,A. (1997) The yeast HPR1 gene has a functional role in transcriptional elongation that uncovers a novel source of genome instability. Genes Dev., 11, 3459–3470. [PMC free article] [PubMed]
  • Chávez S., Beilharz,T., Rondón,A.G., Erdjument-Bromage,H., Tempst,P., Svejstrup,J.Q., Lithgow,T. and Aguilera,A. (2000) A protein complex containing Tho2, Hpr1, Mft1 and a novel protein, Thp2, connects transcription elongation with mitotic recombination in Saccharomyces cerevisiae. EMBO J., 19, 5824–5834. [PMC free article] [PubMed]
  • Chávez S., García-Rubio,M., Prado,F. and Aguilera,A. (2001) Hpr1 is preferentially required for transcription of either long or G+C-rich DNA sequences in Saccharomyces cerevisiae. Mol. Cell. Biol., 21, 7054–7064. [PMC free article] [PubMed]
  • Cho E.J., Takagi,T., Moore,C.R. and Buratowski,S. (1997) mRNA capping enzyme is recruited to the transcription complex by phosphorylation of the RNA polymerase II carboxy-terminal domain. Genes Dev., 11, 3319–3326. [PMC free article] [PubMed]
  • Compagnone-Post P.A. and Osley,M.A. (1996) Mutations in the SPT4, SPT5 and SPT6 genes alter transcription of a subset of histone genes in Saccharomyces cerevisiae. Genetics, 143, 1543–1554. [PMC free article] [PubMed]
  • Costa P.J. and Arndt,K.M. (2000) Synthetic lethal interactions suggest a role for the Saccharomyces cerevisiae Rtf1 protein in transcription elongation. Genetics, 156, 535–547. [PMC free article] [PubMed]
  • Ferdous A., Gonzalez,F., Sun,L., Kodadek,T. and Johnston,S.A. (2001) The 19S regulatory particle of the proteasome is required for efficient transcription elongation by RNA polymerase II. Mol. Cell, 7, 981–991. [PubMed]
  • Hartzog G.A., Wada,T., Handa,H. and Winston,F. (1998) Evidence that Spt4, Spt5 and Spt6 control transcription elongation by RNA polymerase II in Saccharomyces cerevisiae. Genes Dev., 12, 357–369. [PMC free article] [PubMed]
  • Jimeno S., Rondón,A.G., Luna,R. and Aguilera,A. (2002) The yeast THO complex and mRNA export factors link RNA metabolism with transcription and genome instability. EMBO J., 21, 3526–3535. [PMC free article] [PubMed]
  • Kaplan C.D., Morris,J.R., Wu,C. and Winston,F. (2000) Spt5 and spt6 are associated with active transcription and have characteristics of general elongation factors in D.melanogaster. Genes Dev., 14, 2623–2634. [PMC free article] [PubMed]
  • Kim J.B. and Sharp,P.A. (2001) Positive transcription elongation factor B phosphorylates hSPT5 and RNA polymerase II carboxyl-terminal domain independently of cyclin-dependent kinase-activating kinase. J. Biol. Chem., 276, 12317–12323. [PubMed]
  • Lee J.M. and Greenleaf,A.L. (1997) Modulation of RNA polymerase II elongation efficiency by C-terminal heptapeptide repeat domain kinase I. J. Biol. Chem., 272, 10990–10993. [PubMed]
  • LeRoy G., Orphanides,G., Lane,W.S. and Reinberg,D. (1998) Requirement of RSF and FACT for transcription of chromatin templates in vitro. Science, 282, 1900–1904. [PubMed]
  • Li J., Horwitz,R., McCracken,S. and Greenblatt,J. (1992) NusG, a new Escherichia coli elongation factor involved in transcriptional antitermination by the N protein of phage λ. J. Biol. Chem., 267, 6012–6019. [PubMed]
  • Lindstrom D.L. and Hartzog,G.A. (2001) Genetic interactions of Spt4-Spt5 and TFIIS with the RNA polymerase II CTD and CTD modifying enzymes in Saccharomyces cerevisiae. Genetics, 159, 487–497. [PMC free article] [PubMed]
  • Lue N.F., Flanagan,P.M., Sugimoto,K. and Kornberg,R.D. (1989) Initiation by yeast RNA polymerase II at the adenoviral major late promoter in vitro. Science, 246, 661–664. [PubMed]
  • Malagón F. and Aguilera,A. (1996) Differential intrachromosomal hyper-recombination phenotype of spt4 and spt6 mutants of S. cerevisiae. Curr. Genet., 30, 101–106. [PubMed]
  • Mumberg D., Muller,R. and Funk,M. (1994) Regulatable promoters of Saccharomyces cerevisiae: comparison of transcriptional activity and their use for heterologous expression. Nucleic Acids Res., 22, 5767–5768. [PMC free article] [PubMed]
  • Orphanides G., LeRoy,G., Chang,C.H., Luse,D.S. and Reinberg,D. (1998) FACT, a factor that facilitates transcript elongation through nucleosomes. Cell, 92, 105–116. [PubMed]
  • Otero G., Fellows,J., Li,Y., de Bizemont,T., Dirac,A.M., Gustafsson,C.M., Erdjument-Bromage,H., Tempst,P. and Svejstrup,J.Q. (1999) Elongator, a multisubunit component of a novel RNA polymerase II holoenzyme for transcriptional elongation. Mol. Cell, 3, 109–118. [PubMed]
  • Piruat J.I. and Aguilera,A. (1998) A novel yeast gene, THO2, is involved in RNA pol II transcription and provides new evidence for transcriptional elongation-associated recombination. EMBO J., 17, 4859–4872. [PMC free article] [PubMed]
  • Pokholok D.K., Hannett,N.M. and Young,R.A. (2002) Exchange of RNA polymerase II initiation and elongation factors during gene expression in vivo. Mol. Cell, 9, 799–809. [PubMed]
  • Ponting C.P. (2002) Novel domains and orthologues of eukaryotic transcription elongation factors. Nucleic Acids Res., 30, 3643–3652. [PMC free article] [PubMed]
  • Prado F. and Aguilera,A. (1994) New in vivo cloning methods by homologous recombination in yeast. Curr. Genet., 25, 180–183. [PubMed]
  • Prado F. and Aguilera,A. (1995) Role of reciprocal exchange, one-ended invasion crossover and single-strand annealing on inverted and direct repeat recombination in yeast: different requirements for the RAD1, RAD10 and RAD52 genes. Genetics, 139, 109–123. [PMC free article] [PubMed]
  • Prado F., Piruat,J.I. and Aguilera,A. (1997) Recombination between DNA repeats in yeast hpr1delta cells is linked to transcription elongation. EMBO J., 16, 2826–2835. [PMC free article] [PubMed]
  • Renner D.B., Yamaguchi,Y., Wada,T., Handa,H. and Price,D.H. (2001) A highly purified RNA polymerase II elongation control system. J. Biol. Chem., 276, 42601–42609. [PubMed]
  • Sayre M.H., Tschochner,H. and Kornberg,R.D. (1992) Purification and properties of Saccharomyces cerevisiae RNA polymerase II general initiation factor a. J. Biol. Chem., 267, 23383–23387. [PubMed]
  • Schultz M.C., Choe,S.Y. and Reeder,R.H. (1991) Specific initiation by RNA polymerase I in a whole-cell extract from yeast. Proc. Natl Acad. Sci. USA, 88, 1004–1008. [PMC free article] [PubMed]
  • Shaw R.J. and Reines,D. (2000) Saccharomyces cerevisiae transcription elongation mutants are defective in PUR5 induction in response to nucleotide depletion. Mol. Cell. Biol., 20, 7427–7437. [PMC free article] [PubMed]
  • Shilatifard A., Lane,W.S., Jackson,K.W., Conaway,R.C. and Conaway,J.W. (1996) An RNA polymerase II elongation factor encoded by the human ELL gene. Science, 271, 1873–1876. [PubMed]
  • Sikorski R.S. and Hieter,P. (1989) A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics, 122, 19–27. [PMC free article] [PubMed]
  • Squazzo S.L., Costa,P.J., Lindstrom,D.L., Kumer,K.E., Simic,R., Jennings,J.L., Link,A.J., Arndt,K.M. and Hartzog,G.A. (2002) The Paf1 complex physically and functionally associates with transcription elongation factors in vivo. EMBO J., 21, 1764–1774. [PMC free article] [PubMed]
  • Strässer K. et al. (2002) TREX is a conserved complex coupling transcription with messenger RNA export. Nature, 417, 304–308. [PubMed]
  • Sullivan S.L. and Gottesman,M.E. (1992) Requirement for E.coli NusG protein in factor-dependent transcription termination. Cell, 68, 989–994. [PubMed]
  • van Gool A.J., Citterio,E., Rademakers,S., van Os,R., Vermeulen,W., Constantinou,A., Egly,J.M., Bootsma,D. and Hoeijmakers,J.H. (1997) The Cockayne syndrome B protein, involved in transcription-coupled DNA repair, resides in an RNA polymerase II-containing complex. EMBO J., 16, 5955–5965. [PMC free article] [PubMed]
  • Wada T. et al. (1998a) DSIF, a novel transcription elongation factor that regulates RNA polymerase II processivity, is composed of human Spt4 and Spt5 homologs. Genes Dev., 12, 343–356. [PMC free article] [PubMed]
  • Wada T., Takagi,T., Yamaguchi,Y., Watanabe,D. and Handa,H. (1998b) Evidence that P-TEFb alleviates the negative effect of DSIF on RNA polymerase II-dependent transcription in vitro. EMBO J., 17, 7395–7403. [PMC free article] [PubMed]
  • Wada T. et al. (2000) FACT relieves DSIF/NELF-mediated inhibition of transcriptional elongation and reveals functional differences between P-TEFb and TFIIH. Mol. Cell, 5, 1067–1072. [PubMed]
  • Wind M. and Reines,D. (2000) Transcription elongation factor SII. BioEssays, 22, 327–336. [PMC free article] [PubMed]
  • Winston F. and Carlson,M. (1992) Yeast SNF/SWI transcriptional activators and the SPT/SIN chromatin connection. Trends Genet., 8, 387–391. [PubMed]
  • Wittschieben B.O. et al. (1999) A novel histone acetyltransferase is an integral subunit of elongating RNA polymerase II holoenzyme. Mol. Cell, 4, 123–128. [PubMed]
  • Woontner M., Wade,P.A., Bonner,J. and Jaehning,J.A. (1991) Transcriptional activation in an improved whole-cell extract from Saccharomyces cerevisiae. Mol. Cell. Biol., 11, 4555–4560. [PMC free article] [PubMed]
  • Wyrick J.J., Holstege,F.C., Jennings,E.G., Causton,H.C., Shore,D., Grunstein,M., Lander,E.S. and Young,R.A. (1999) Chromosomal landscape of nucleosome-dependent gene expression and silencing in yeast. Nature, 402, 418–421. [PubMed]
  • Yamaguchi Y., Takagi,T., Wada,T., Yano,K., Furuya,A., Sugimoto,S., Hasegawa,J. and Handa,H. (1999a) NELF, a multisubunit complex containing RD, cooperates with DSIF to repress RNA polymerase II elongation. Cell, 97, 41–51. [PubMed]
  • Yamaguchi Y., Wada,T., Watanabe,D., Takagi,T., Hasegawa,J. and Handa,H. (1999b) Structure and function of the human transcription elongation factor DSIF. J. Biol. Chem., 274, 8085–8092. [PubMed]
  • Yamaguchi Y., Inukai,N., Narita,T., Wada,T. and Handa,H. (2002) Evidence that negative elongation factor represses transcription elongation through binding to a DRB sensitivity-inducing factor/RNA polymerase II complex and RNA. Mol. Cell. Biol., 22, 2918–2927. [PMC free article] [PubMed]

Articles from The EMBO Journal are provided here courtesy of The European Molecular Biology Organization
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

  • Gene
    Gene
    Gene links
  • GEO Profiles
    GEO Profiles
    Related GEO records
  • HomoloGene
    HomoloGene
    HomoloGene links
  • MedGen
    MedGen
    Related information in MedGen
  • Pathways + GO
    Pathways + GO
    Pathways, annotations and biological systems (BioSystems) that cite the current article.
  • Protein
    Protein
    Published protein sequences
  • PubMed
    PubMed
    PubMed citations for these articles
  • Substance
    Substance
    PubChem Substance links
  • Taxonomy
    Taxonomy
    Related taxonomy entry
  • Taxonomy Tree
    Taxonomy Tree

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...