• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of pnasPNASInfo for AuthorsSubscriptionsAboutThis Article
Proc Natl Acad Sci U S A. Jan 3, 2006; 103(1): 230–235.
Published online Dec 27, 2005. doi:  10.1073/pnas.0509875103
PMCID: PMC1325009
Plant Biology

Cinnamoyl-CoA reductase, a key enzyme in lignin biosynthesis, is an effector of small GTPase Rac in defense signaling in rice

Abstract

OsRac1, one of the Rac/Rop family of small GTPases, plays important roles in defense responses, including a role in the production of reactive oxygen species mediated by NADPH oxidase. We have identified an effector of OsRac1, namely rice (Oryza sativa) cinnamoyl-CoA reductase 1 (OsCCR1), an enzyme involved in lignin biosynthesis. Lignin, which is polymerized through peroxidase activity by using H2O2 in the cell wall, is an important factor in plant defense responses, because it presents an undegradable mechanical barrier to most pathogens. Expression of OsCCR1 was induced by a sphingolipid elicitor, suggesting that OsCCR1 participates in defense signaling. In in vitro interaction and two-hybrid experiments, OsRac1 was shown to bind OsCCR1 in a GTP-dependent manner. Moreover, the interaction of OsCCR1 with OsRac1 led to the enzymatic activation of OsCCR1 in vitro. Transgenic cell cultures expressing the constitutively active OsRac1 accumulated lignin through enhanced CCR activity and increased reactive oxygen species production. Thus, it is likely that OsRac1 controls lignin synthesis through regulation of both NADPH oxidase and OsCCR1 activities during defense responses in rice.

Keywords: defense response, G protein, monolignol

Plants develop immune systems to inhibit infection by pathogens. These immune systems are initiated by both general recognition of microbe-associated molecules and the specific recognition of particular pathogen-encoded molecules through the action of plant disease resistance proteins (1). The recognition of pathogens triggers a series of defense responses, including production of reactive oxygen species (ROS), pathogen-related (PR) gene expression, lignification, and production of antimicrobial compounds. These responses result in effective restriction of pathogen growth at the infected site (2). In many cases, the defense responses involve rapid cell death, a process known as hypersensitive response (HR) (2).

Lignin, a major component of secondary cell walls, is a heterogeneous tridimensional phenolic polymer resulting from the oxidative polymerization of monolignols (3, 4). During defense responses, lignin and lignin-like phenolic compounds accumulate throughout the HR region in many plant–microbe interactions (58). During plant development, lignin is deposited mainly in the vascular tissues and provides additional strength and imperviousness to the cell wall (4). Deposition of lignin during defense responses is considered to function as a physical barrier against infection of pathogens (9). In general, the monomeric composition of lignins varies during plant development (6). The structural analysis of lignins induced by an elicitor prepared from Rhizosphaera kalkhoffii in spruce reveals that the defense lignins resemble but are significantly different from those of developmental lignins (6). Thus, it is likely that lignin biosynthesis is differentially regulated in development of vascular tissues and plant defense responses.

The cinnamolyl-CoA esters, the precursors of monolignol biosynthesis, are generated by the general phenylpropanoid pathway and then converted into monolignols by two enzymes, cinnamoyl-CoA reductase (CCR) and cinnamyl alcohol dehydrogenase (CAD) (4). So far, a few genes encoding CCR and CAD have been shown to be transcriptionally induced by infection with pathogens in Arabidopsis and rice (10, 11). The monolignols catalyzed by CCR and CAD are transferred into the cell wall and polymerized by peroxidase with H2O2 (4). H2O2 induced as one of the defense responses may stimulate polymerization of monolignols in the infected regions. It is also possible that monolignols have antimicrobial activity, as has been reported by Keen and Littlefield (12).

Plant Rac/Rop small GTPases are highly conserved in the plant kingdoms and constitute a unique subfamily of the Rho family of small GTPases (13). In rice, there are seven genes OsRac1–OsRac7 (14), whereas 11 members are found in Arabidopsis (13). The Rac GTPases are regulated by their shuttling between the GDP-bound inactive and the GTP-bound active forms. The constitutively active (CA) and dominant-negative (DN) mutants of Rac GTPase can be produced by substitution of the amino acids corresponding to the CA and DN mutations of animal ras GTPase (13). Because loss-of-function mutants are likely to show no clear phenotypic effects due to gene redundancy, CA- and DN-mutants have become important tools to elucidate the function of Rac GTPases. Accumulating evidence indicates that Rac GTPases are involved in pollen tube elongation, root hair development, defense response, and hormone signaling (13). However, only a few effectors of Rac GTPase have been identified in plants (13, 15, 16).

The Rac GTPases play important roles in defense responses in rice (17). Expression of CA-OsRac1 results in enhanced resistance to rice blast and bacterial blight (18, 19). DN-OsRac1 suppresses HR induced by incompatible rice blast fungus, indicating that OsRac1 is one of the key regulators in defense responses in rice (18). The involvement of Rac GTPases in the defense response has been demonstrated in various plant species, including rice, Arabidopsis, tobacco, and soybean (18, 2022).

One of the important functions of Rac GTPases in defense responses is regulation of NADPH oxidase-dependent ROS production. Our previous findings revealed that, in elicitor signaling, OsRac1 functions as a positive regulator of NADPH oxidase activation (17) and at the same time suppresses expression of a scavenger metallothionein (23), which results in transient accumulation of ROS. Transient ROS accumulation likely contributes to the enhancement of the ROS-dependent defense signals. In contrast, some Rac GTPases also function as negative regulators for ROS production in tobacco and barley (24, 25), suggesting that the Rac GTPases may regulate defense responses through both positive and negative controls of defense signals. Recently, we also found that OsRac1 regulates the stability and activation of a rice mitogen-activated protein (MAP) kinase, OsMAPK6, which is highly homologous to tobacco SIPK and Arabidopsis AtMPK6 and is activated by a sphingolipid elicitor (SE) (26). Thus, Rac GTPases are involved in multiple steps of defense responses.

In the present study, we have identified rice Oryza sativa CCR1 (OsCCR1) as an effector for OsRac1. Expression of OsCCR1 is induced by a SE, suggesting that OsCCR1 is most likely involved in the defense response. OsRac1 interacts with OsCCR1 in yeast and in vitro in a GTP-dependent manner. The interaction of OsCCR1 with OsRac1 leads to the enzymatic activation of OsCCR1 in vitro. In addition, CA-OsRac1 enhances CCR activity in rice cell cultures, which results in a higher accumulation of lignin. Thus, it is possible that OsRac1 stimulates production of monolignol through the regulation of CCR. Furthermore, activation of NADPH oxidase by OsRac1 may contribute to H2O2-dependent polymerization of lignin. The dual function of OsRac1 on regulation of CCR and NADPH oxidase may be a key controlling element of lignin biosynthesis in defense responses.

Materials and Methods

Rice Cell Cultures and Elicitor Treatment. Rice cell cultures expressing the CA- and DN-OsRac1 were generated as described (17). For analysis of gene expression, rice cell cultures were collected after treatment with 5 μg/ml of a SE prepared from rice blast fungus (27). Total RNAs were purified from each sample and subjected to RT-PCR by using primers specific for OsCCR1 (forward, CTCATCCGTGGCTACCACGTC; reverse, GGGTAGGACTTCTTGGTGCC). The primers for OsRac1, PBZ1, actin, and ubiquitin were as described (23).

Yeast Two-Hybrid Constructions and Methods. A CA-OsRac1 bait was produced by cloning into the pBYM116 vector (28). Poly (A)+ RNAs were isolated from rice cell culture treated with a protein phosphatase inhibitor, calyculin A, and used for construction of a cDNA library with a cDNA synthesis kit (GIBCO/BRL). The resultant cDNAs were inserted into the pVP16 vector and introduced into cells of Saccharomyces cerevisiae L40 (28). Independent clones (2.2 × 106) were screened for interaction with OsRac1. For the two-hybrid assay, a fragment of DN-OsRac1 was introduced into the pBYM116 bait vector, and prey vectors containing different fragments of OsCCR1 were made by using the pVP16 vector. All screening and interaction assays were performed as described (28).

Transient Expression in Rice Protoplasts. The GFP sequence derived from sGFP-S65T was fused to the C terminus of OsCCR1 (23). Expression of GFP alone and OsCCR1-GFP was driven by the 35S promoter of cauliflower mosaic virus in these constructs. Protoplast isolation and electroporation were performed as described (23). After a 24-h incubation at 30°C, the protoplasts were examined under a confocal microscope (LSM510, Zeiss).

In Vitro Interaction Experiment. Full length OsCCR1 fragment with an N-terminal His epitope tag was expressed by using pET30 (Novagene, Madison, WI). The OsRac1 cDNA fragment was cloned into pGEX4T-1 (Amersham Pharmacia) to produce GST-fused protein. Both His-OsCCR and GST-OsRac1 proteins were expressed in Escherichia coli and extracted by using standard protocols. The GST-OsRac1 protein coupled to glutathione Sepharose 4B beads was incubated with GTPγSorGDPβS. GST and GTPγS- or GDPβS-bound GST-OsRac1 proteins were incubated with His-OsCCR in TEDM buffer (20 mM Tris·HCl, pH 8.0/1 mM EDTA/5 mM MgCl2/1 mM DTT/10% sucrose/10 μM leupeptin/10 μM PMSF). After incubation, beads were washed with TEDM buffers containing 0 mM, 150 mM, 300 mM, and 500 mM NaCl with or without 0.1% Triton X-100. After the final wash, bound proteins were eluted with 10 mM glutathione. SDS/PAGE, immunoblotting, and Coomassie staining were performed by using standard protocols.

CCR Activity Assay. OsCCR1 activity was measured by using feruloyl-CoA as a substrate, as described (29). Feruloyl-CoA was prepared according to Stöckigt and Zenk (30). Briefly, 5 μg of His-OsCCR1 protein was incubated with 5 μg of GTP-bound GST-OsRac1 proteins and GST in CCR buffer (100 mM sodium/potassium phosphate, pH 6.25/0.1 mM NADPH) (total volume 200 μl) at 30°C for 30 min. After incubation at 30°C for 30 min, the reaction mixture was extracted with 500 μl of ethyl acetate containing an internal standard (0.25 μg of coniferylaldehyde-d3). The ethyl acetate extracts were dried and then dissolved in N,O-bis (trimethylsilyl) acetamide. After standing at 60°C for 45 min, an aliquot of the solution was subjected to GC-MS analysis, and the products were identified and quantified. GC-MS analysis was performed on a Shimadzu QP-5050A GC-MS system (Shimadzu) [electron impact mode (70 eV); column a Shimadzu Hicap CBP10-M25–025 column (20 m × 0.22 mm); carrier gas, helium; injection temperature, 240°C; column temperature, 40°C at t = 0–2 min, then to 230°C at 25°C per min].

One gram (fresh weight) of rice suspension cells was ground in liquid nitrogen, and total proteins were extracted in 0.1 M Tris·HCl, pH 7.5/2% polyethylene glycol 6000 (wt/vol)/5 mM DTT/2% polyvinylpolypyrrolidone (wt/vol) (31). The crude extracts were clarified by centrifugation at 16,000 × g for 10 min at 4°C. Total CCR activity was measured by using the same protocol as used in the experiments by using the recombinant proteins.

Thioglycolic-Acid Assay. Rice suspension cells (0.5 gram fresh weight) were ground in liquid nitrogen. Thioglycolic acid (TGA)-extractable cell wall complexes were purified as described (7). The purified cell wall complexes were dissolved in 1 M NaOH, and the absorbance of the samples at 280 nm was recorded by using a spectrophotometer (Beckman).

Results

Identification of OsCCR1 as an Effector of OsRac1. To identify OsRac1 effectors, two-hybrid screening was carried out by using the CA mutant of OsRac1 (CA-OsRac1) as bait. The CA-OsRac1 mutant had been previously produced by substitution from glycine to valine at position 19 (17). This mutation results in constitutive GTP binding due to the loss of the GTPase activity. A rice cDNA library was prepared from suspension cell cultures treated with a protein phosphatase inhibitor, calyculin A, which is known to induce a series of defense responses in rice (32). Independent clones (2.2 × 106) were screened, and 40 positive clones were found as candidates of the CA-OsRac1 effectors. One of them encoded a protein exhibiting high similarity to cinnamoyl CoA reductase (CCR), an enzyme that catalyzes the conversion of hydroxycinrnamoyl-CoA esters to their corresponding cinnamaldehydes, which is the first committed step of the lignin branch pathway (33); it was designated OsCCR1. The deduced OsCCR1 protein is 338 amino acid residues in length with an estimated molecular mass of 37,389 Da. A homology search indicates there are 26 CCR-like genes in rice (see Fig. 6 and Table 1, which are published as supporting information on the PNAS web site). All of the CCR-like genes contain NADPH-binding and catalytic motifs, which are characteristics of CCR proteins (33), although there are small diversities in the motifs among rice CCR-like genes (data not shown). Eleven CCR-like genes are annotated in Arabidopsis (34).

Lignin and lignin-related compounds are induced by infection with pathogens. To clarify the involvement of OsCCR1 in defense responses, expression of OsCCR1 was examined in rice suspension cell cultures treated with a SE purified from rice blast Magnaporthe grisea. SEs are well characterized as effective elicitors of defense responses in rice (27). Expression of OsCCR1 was induced at 2 h after SE treatment (Fig. 1A). The expression pattern was similar to the PBZ1 gene that is one of the well characterized defense-related genes in rice (35). OsCCR1 expression was not detected in whole plants, although some OsCCR genes exhibited constitutive expression (data not shown). It seems that the OsCCR genes are differentially regulated at the transcriptional level in development and the defense response. Thus, it is most likely that OsCCR1 is involved in lignin synthesis associated with defense response but not in development.

Fig. 1.
Expression and intracellular localization of OsCCR1. (A) Expression of OsCCR1 after SE treatment. Total RNAs were purified from rice suspension culture cells treated with 5 μg/ml SE. RT-PCR with primers specific for OsCCR1, PBZ1, and actin was ...

To identify the intracellular localization of OsCCR1, GFP was fused to the C terminus of OsCCR1. The OsCCR1-GFP protein was expressed in rice protoplasts by introducing the plasmid DNA by using electroporation (Fig. 1B). OsCCR1-GFP was localized in the cytoplasm, as was GFP alone. This is consistent with the finding that the protein sequence of OsCCR1 protein does not contain any intracellular localization signals (data not shown). Because CA-OsRac1 is localized at the plasma membrane (PM) (18), the interaction of OsRac1 and OsCCR1 is likely to take place in the vicinity of the PM (see below).

Interaction of OsCCR1 with OsRac1 in Yeast. Yeast two-hybrid assays were conducted to investigate the interactions between OsRac1 and OsCCR1 (Fig. 2). Ten prey vectors were generated by using different regions of the OsCCR1 protein. The C2 fragment (amino acids 8–251) is the fragment identified originally from the yeast two-hybrid screening. We also produced another bait vector containing a DN form of OsRac1 in which threonine was changed to asparagine at position 24 (17). Expression of all OsRac1 and CCR proteins was confirmed in yeast by immunoblotting (data not shown). The C2 fragment specifically interacted with CA-OsRac1 but not with DN-OsRac1, indicating that the interaction is GTP-dependent. The C3 fragment also interacted with CA-OsRac1 in the same manner as C2, indicating that the N-terminal region (amino acids 1–8) is not involved in the interaction between OsRac1 and OsCCR1. However, full length OsCCR1 protein (C1; amino acids 1–338) did not bind with CA-OsRac1, suggesting that the C-terminal region (amino acids 252–338) of OsCCR1 has a negative effect on the interaction with CA-OsRac1 in yeast. The C8 fragment, which has a C-terminal deletion of seven amino acids compared with C3, lost the binding activity with CA-OsRac1. Thus a 7-aa sequence between amino acids 244 and 251 is required for the interaction. The N-terminal region between amino acids 1 and 97 was also shown to be required for the interaction, because the C9 fragment (amino acids 97–251) could not bind CA-OsRac1. The data indicate that the interaction with OsRac1 requires a relatively large region of OsCCR1.

Fig. 2.
OsCCR1 interacts with CA-OsRac1 but not DN-OsRac1 in yeast. The CA-OsRac1 and DN-OsRac1 fragments were inserted into the bait vector. Various OsCCR1 fragments (Left) were inserted into the prey vectors. The designation of each fragment is on the left. ...

OsRac1 Regulates OsCCR1 Activity in Vitro. An in vitro binding assay was used to confirm the interaction between OsCCR1 and OsRac1. We produced His-tagged OsCCR1 protein (His-OsCCR1) and the OsRac1 protein (GST-OsRac1) fused to GST by using expression systems in E. coli. The GST-OsRac1 protein was bound to glutathione Sepharose 4B, washed, then incubated with or without GTPγSorGDPβS, and then incubated with the His-OsCCR1 protein. After various different washing conditions, the eluted proteins were subjected to SDS/PAGE and immunoblotting with an anti-His antibody. As shown in Fig. 3A, the His-OsCCR1 protein bound specifically to GTP-OsRac1, but not to GDP-OsRac1, with washing buffer containing 150 mM NaCl and 0.1% Triton X-100. This interaction was abolished with higher concentrations (300 and 500 mM) of NaCl. However, both GTP- and GDP-OsRac1 could stably bind His-OsCCR1 under low-stringency wash conditions without NaCl and Triton X-100. Thus, it was concluded that the His-OsCCR1 protein has higher affinity for GTP-OsRac1 than GDP-OsRac1, a conclusion also consistent with the results of the two-hybrid experiments. Furthermore, the full length OsCCR1 protein was able to interact with OsRac1 in in vitro experiments in contrast to the yeast experiments, where the interaction could not be detected (Fig. 2).

Fig. 3.
OsRac1 activates OsCCR1 activity in vitro. (A) In vitro interaction between OsRac1 and OsCCR1. The entire ORF of OsRac1 was inserted into the pGEX4T-1 vector (Amersham Pharmacia) to produce a GST fusion. The OsCCR1 fragment was inserted into the pET30 ...

We tested the possibility that OsRac1 directly regulates OsCCR1 enzyme activity by using an in vitro system. Feruloyl-CoA, synthesized as described (30), was used as a substrate for OsCCR1. Because CCR catalyzes a conversion of feruloyl-CoAs into coniferyl aldeyde, amounts of coniferyl aldeyde were measured by GC-MS. The His-OsCCR1 protein alone exhibited an activity of 0.05 nmol/μg protein in a 30-min reaction time, which was indicated as a standard value in Fig. 3B. The activity was lost by boiling, confirming that the activity is due to His-OsCCR1. GST alone did not have any effects on OsCCR1 activity. The His-OsCCR1 activity was enhanced ≈10-fold by coincubation of GTP-bound GST-OsRac1 with His-OsCCR1. The same results were observed in repeated experiments. Unexpectedly, GDP-OsRac1 also activated OsCCR1 at a similar level as GTP-OsRac1 (data not shown). This may be explained by the fact that, under the in vitro binding conditions using a buffer suitable for measuring CCR activity, GDP-OsRac1 also bound OsCCR1 (Fig. 3A; see Materials and Methods). Taken together, these results showed that OsRac1 has an ability to enhance the OsCCR1 enzyme activity in vitro.

OsRac1 Stimulates Lignin Synthesis in Rice Suspension Cell Culture. Because CCR is located on a branch point between the general phenylpropanoid pathway and monolignol biosynthesis, CCR is considered to be a potential control point regulating the overall carbon flux toward lignins (33). Therefore, activation of CCR is predicted to result in enhanced lignin synthesis in cells. Transgenic cell cultures overexpressing CA-OsRac1 or DN-OsRac1 were generated by using a lesion mimic mutant, namely the Sekiguchi lesion (sl). This is a propagation type of lesion mimic mutant that induces yellow-brownish lesions accompanied with lignin formation in plant leaves (17). We measured TGA-extractable cell wall complexes that are commonly thought to be lignin (Fig. 4A; refs. 6, 7, and 36). The TGA-extractable lignins are known to be induced by fungal elicitor in pine and spruce cell cultures (6, 7, 36). Overexpression of OsRac1 was confirmed by RT-PCR (Fig. 4B). CA- and DN-OsRac1 did not affect expression of OsCCR1. The amounts of TGA-extractable lignins were increased in transgenic cell cultures expressing CA-OsRac1 (CA4 and CA7) but not DN-OsRac1 (DN1) compared with the nontransgenic (NT) cell culture. Total CCR activities were measured by using total proteins prepared from the transgenic cell cultures (Fig. 4C). The total CCR activities in the CA-OsRac1 cells were 5- to 7-fold higher than the NT cell, whereas DN-OsRac1 did not affect total CCR activities, indicating that OsRac1 is able to enhance the CCR activity in vivo in cell cultures.

Fig. 4.
CA-OsRac1 enhances lignin synthesis in rice suspension cell cultures. (A) Measurement of TGA-extractable lignin contents in Sekiguchi lesion (sl) mutant cells expressing CA- or DN-OsRac1. The lignin contents are indicated as values of absorbance at 280 ...

Discussion

In this work, we have identified OsCCR1 as an effector for OsRac1. CCR catalyzes the conversion of cinnamoyl-CoAs into their corresponding cinnamaldehydes, which is considered as a potential control point regulating the overall carbon flux toward lignin production (31, 33). Lignins and lignin-related compounds are known to be induced at sites of pathogen infection (5). Because lignins are extremely resistant to microbial degradation, it is possible that deposition of lignin reinforces cell wall. Such reinforcement is an effective defense response against infection by pathogens (6, 7). In addition, many antimicrobial substances such as phytoalexins are known to be produced by the monolignol synthetic pathways (12). It is therefore likely that lignin and lignin-related compounds with antimicrobial activities cooperatively play important roles in disease resistance of various plant species.

A homology search looking at the genes involved in the monolignol biosynthetic pathway indicates there are 11 putative CCR genes and 9 putative CAD genes in Arabidopsis (34). Among them, two CCR genes (AtCCR1 and AtCCR2) have been characterized by molecular and biochemical experiments (10). AtCCR2 is induced by infection with Xanthomonas campestris (10) in the same way that OsCCR1 is induced by SE, whereas AtCCR1 exhibits the constitutive expression in all tissues tested. Our preliminary experiments indicate that OsCCR3 is induced by the elicitor, whereas OsCCR5 is constitutively expressed in rice (data not shown). As suggested by several reports (10, 34), the CCR family may be divided into two groups: one involved in defense responses and the other in development, although these two groups cannot be distinguished based on the sequence similarities. It is possible that the CCR group involved in defense responses may produce lignin-related phenolic compounds with antimicrobial activities not required for normal development, in addition to lignin.

As described above, CCR constitute large families in rice and Arabidopsis. The large gene family suggests the presence of functional redundancy in the lignin biosynthetic pathway. In fact, to analyze the function of OsCCR1 in lignification during the defense response, transgenic rice plants specifically suppressing the OsCCR1 expression were produced by RNA interference (RNAi). In the OsCCR1-RNAi plants, lignification still occurred at HR sites induced by incompatible blast fungus (data not shown). These results suggest that there is functional redundancy in the OsCCR genes in rice.

OsCCR1-GFP localized to the cytoplasm when it was transiently expressed in the cells, which is consistent with the fact that OsCCR1 does not have any localization signals. As described (18), OsRac1 is localized at the PM, suggesting that the part of OsCCR1 is likely to interact with OsRac1 in the vicinity of the PM. In addition, it is also possible that OsCCR1 may move to the PM during the defense response and interact with OsRac1, or that activation of OsRac1 may affect the localization of OsCCR1. Future study may reveal in vivo interaction and colocalization of OsRac1 and OsCCR1.

Yeast two-hybrid experiments and in vitro pull-down assays indicate that the GTP-form of OsRac1 has higher affinity for OsCCR1 than the GDP form. Although a series of deletion constructs of OsCCR1 was produced to specify the interacting domains of OsCCR1, the interaction with OsRac1 was shown to require a relatively large region of OsCCR1. OsCCR1 was strongly activated in vitro by coincubation with OsRac1. It seems that somehow the interaction with OsRac1 may change the CCR structure from an inactive to an active state. Many effectors of the animal ras superfamily of small GTPases, including Rac, are regulated by autoinhibition in which the activity of effectors is inhibited through intramolecular association. For example, Diaphanous-related formins (DRFs) that are the effectors of the small GTPase RhoA are autoinhibited by intramolecular interaction between an autoinhibitory and an output domain (37). This intramolecular interaction is prevented by binding to RhoA, which results in activation of DRFs with subsequent transmission of signals downstream. Similar regulation by small GTPases is found in several effectors, including Pak (38) and Raf (39). In this scenario, if OsCCR1 has an autoinhibitory domain, the autoinhibition may be suppressed by the binding of OsRac1. An alternative method of regulation may be similar to that seen with the small GTPase Cdc42, which functions as an allosteric effector for its target WASP (40). Similarly, the interaction with OsRac1 may lead to a conformational change of the OsCCR1 protein in which OsCCR1 may be changed from an inactive to an active state. Structural analysis of the OsCCR protein is required to elucidate the mechanism of OsCCR1 activation.

Transgenic cells expressing CA-OsRac1 accumulate TGA-extractable lignins with a concomitant increase in total CCR activity. In these experiments, OsCCR1 activity could not be distinguished from total CCR activities. The lignin level of DN-OsRac1 cells was the same as nontransformed control, indicating that the effect of OsRac1 on lignin production is GTP-dependent. These results also indicate that the in vivo interaction of OsRac1 with OsCCR1 is regulated in GTP-dependent manner. We were unable to observe negative effects of DN-OsRac1 on the steady-state level of lignin and the total CCR activities, suggesting that most CCR proteins may be regulated in an OsRac1-independent manner. OsRac1 may therefore control one of the CCR groups, including OsCCR1, specifically in defense response.

Transcription of genes involved in the lignin biosynthetic pathway has been shown to be coordinately regulated (8). Preliminary microarray experiments of rice culture cells indicate that some of the genes encoding 4-coumarate-3-hydroxylase, caffeic acid 3-O-methyltransferase, and CAD are up-regulated by CA-OsRac1 (unpublished results). Thus, it is possible that the OsRac1-mediated signaling pathway may control the transcriptome of lignin biosynthetic genes in rice.

In our previous results, OsRac1 was shown to enhance NADPH oxidase-dependent ROS production in a GTP-dependent manner in rice (17). The roles of Rac/Rop GTPase on ROS production have been elucidated in many plants including Arabidopsis, soybean, tobacco, and cotton (20, 21, 41). In plants, respiratory burst oxidase homologues (Rbohs) are known to function as major NADPH oxidases on the PM (42). Rbohs are known to strongly contribute to ROS production during the defense response, because loss-of-function mutations of Rbohs result in drastic reduction of ROS production (42). Our recent experiments show that the Rac GTPase regulates the Rboh enzymatic activity by direct interaction (unpublished results). In tobacco, Rac GTPase and Rboh have been shown to be colocalized in lipid rafts at PM (43). The Rboh-mediated ROS are most likely to be used to polymerize monolignols in the cell wall. The present results indicate that OsRac1 activates CCR activity by direct interaction, which leads to efficient production of monolignols. Thus, it is likely that OsRac1 has a dual function in lignin synthesis to regulate both NADPH oxidase (Rboh) and the CCRs (Fig. 5). Because transgenic CA-OsRac1 plants enhanced the HR accompanied by lignin formation (18), it is likely that regulation of CCR activity by OsRac1 contributes to disease resistance in rice.

Fig. 5.
Proposed model for the dual function of OsRac1 in lignin biosynthesis. CCR catalyzes the first step of the monolignol-specific branch from the phenylpropanoid pathway. CCR is therefore considered as a potential control point regulating the overall carbon ...

Supplementary Material

Supporting Information:

Acknowledgments

We thank Dr. Ryuichi Nishihama and Prof. Yasunori Machida for technical advice on the two-hybrid screening. This work was supported by Grant-in-Aid for Scientific Research 15688002 from the Ministry of Education, Science, and Culture of Japan (to T.K.) and a Grant-in-Aid from the Ministry of Agriculture, Forestry, and Fisheries of Japan (Rice Genome Project IP4001, to K.S.).

Notes

Author contributions: T.K., T.U., and K.S. designed research; T.K., H.K., T.N., K.H., K.W., and H.T. performed research; K.U. contributed new reagents/analytic tools; T.K. analyzed data; and T.K., T.U., and K.S. wrote the paper.

Conflict of interest statement: No conflicts declared.

Abbreviations: CCR, cinnamoyl-CoA reductase; OsCCR1, Oryza sativa CCR1; ROS, reactive oxygen species; HR, hypersensitive response; PM, plasma membrane; CAD, cinnamyl alcohol dehydrogenase; CA, constitutively active; DN, dominant negative; TGA, thioglycolic acid; SE, sphingolipid elicitor; NT, nontransgenic; Rboh, respiratory burst oxidase homologue.

References

1. Zipfel, C. & Felix, G. (2005) Curr. Opin. Plant Biol. 8, 353–360. [PubMed]
2. Greenberg, J. T. & Yao, N. (2004) Cell Microbiol. 6, 201–211. [PubMed]
3. Higuchi, T. (1985) in Biosynthesis and Biodegradation of Wood Components, ed. Higuchi, T. (Academic, Orlando, FL), pp. 141–160.
4. Boerjan, W., Ralph, J. & Baucher, M. (2003) Annu. Rev. Plant Biol. 54, 519–546. [PubMed]
5. Reimers, P. J. & Leach, J. E. (1991) Physiol. Mol. Plant Pathol. 38, 39–55.
6. Lange, B. M., Lapierre, C. & Sandermann, H., Jr. (1995) Plant Physiol. 108, 1277–1287. [PMC free article] [PubMed]
7. Campbell, M. M. & Ellis, B. E. (1992) Planta 186, 409–417. [PubMed]
8. Anterola, A. M. & Lewis, N. G. (2002) Phytochemistry 61, 221–294. [PubMed]
9. Moershbacher, B., Noll, U., Gorrichon, L. & Reisener, H. J. (1990) Plant Physiol. 93, 465–470. [PMC free article] [PubMed]
10. Lauvergeat, V., Lacomme, C., Lacombe, E., Lasserre, E., Roby, D. & Grima-Pettenati, J. (2001) Phytochemistry 57, 1187–1195. [PubMed]
11. Kim, C. Y., Lee, S. H., Park, H. C., Bae, C. G., Cheong, Y. H., Choi, Y. J., Han, C., Lee, S. Y., Lim, C. O. & Cho, M. J. (2000) Mol. Plant–Microbe Interact. 13, 470–474. [PubMed]
12. Keen, N. T. & Littlefield, L. J. (1979) Physiol. Plant Pathol. 14, 265–280.
13. Gu, Y., Wang, Z. & Yang, Z. (2004) Curr. Opin. Plant Biol. 7, 527–536. [PubMed]
14. Miki, D., Itoh, R. & Shimamoto, K. (2005) Plant Physiol. 138, 1903–1913. [PMC free article] [PubMed]
15. Wu, G., Gu, Y., Li, S. & Yang, Z. (2001) Plant Cell 13, 2841–2856. [PMC free article] [PubMed]
16. Fu, Y., Gu, Y., Zheng, Z., Wasteneys, G. & Yang, Z. (2005) Cell 120, 687–700. [PubMed]
17. Kawasaki, T., Henmi, K., Ono, E., Hatakeyama, S., Iwano, M., Satoh, H. & Shimamoto, K. (1999) Proc. Natl. Acad. Sci. USA 96, 10922–10926. [PMC free article] [PubMed]
18. Ono, E., Wong, H. L., Kawasaki, T., Hasegawa, M., Kodama, O. & Shimamoto, K. (2001) Proc. Natl. Acad. Sci. USA 98, 759–764. [PMC free article] [PubMed]
19. Suharsono, U., Fujisawa, Y., Kawasaki, T., Iwasaki, Y., Satoh, H. & Shimamoto, K. (2002) Proc. Natl. Acad. Sci. USA 99, 13307–13312. [PMC free article] [PubMed]
20. Moeder, W., Yoshioka, K. & Klessig, D. F. (2005) Mol. Plant–Microbe Interact. 18, 116–124. [PubMed]
21. Park, J., Gu, Y., Lee, Y. & Yang, Z. (2004) Plant Physiol. 134, 129–136. [PMC free article] [PubMed]
22. Schiene, K., Puhler, A. & Niehaus, K. (2000) Mol. Gen. Genet. 263, 761–770. [PubMed]
23. Wong, H. L., Sakamoto, T., Kawasaki, T., Umemura, K. & Shimamoto, K. (2004) Plant Physiol. 135, 1447–1456. [PMC free article] [PubMed]
24. Huckelhoven, R. (2005) FEMS Microbiol. Lett. 245, 9–17. [PubMed]
25. Morel, J., Fromentin, J., Blein, J. P., Simon-Plas, F. & Elmayan, T. (2004) Plant J. 37, 282–293. [PubMed]
26. Lieberherr, D., Thao, N. P., Nakashima, A., Umemura, K., Kawasaki, T. & Shimamoto, K. (2005) Plant Physiol. 138, 1644–1652. [PMC free article] [PubMed]
27. Umemura, K., Ogawa, N., Koga, J., Iwata, M. & Usami, H. (2002) Plant Cell Physiol. 43, 778–784. [PubMed]
28. Vojtek, A. B., Hollenberg, S. M. & Cooper, J. A. (1993) Cell 74, 205–214. [PubMed]
29. Goffner, D., Campbell, M. M., Campargue, C., Clastre, M., Borderies, G., Boudet, A. & Boudet, A. M. (1994) Plant Physiol. 106, 625–632. [PMC free article] [PubMed]
30. Stöckigt, J. & Zenk, M. H. (1975) Z. Naturforsch. 30c, 352–358. [PubMed]
31. Chabannes, M., Barakate, A., Lapierre, C., Marita, J. M., Ralph, J., Pean, M., Danoun, S., Halpin, C., Grima-Pettenati, J. & Boudet, A. M. (2001) Plant J. 28, 257–270. [PubMed]
32. Takahashi, A., Kawasaki, T., Henmi, K., Shi, I. K., Kodama, O., Satoh, H. & Shimamoto, K. (1999) Plant J. 17, 535–545. [PubMed]
33. Lacombe, E., Hawkins, S., Van Doorsselaere, J., Piquemal, J., Goffner, D., Poeydomenge, O., Boudet, A. M. & Grima-Pettenati, J. (1997) Plant J. 11, 429–441. [PubMed]
34. Costa, M. A., Collins, R. E., Anterola, A. M., Cochrane, F. C., Davin, L. B. & Lewis, N. G. (2003) Phytochemistry 64, 1097–1112. [PubMed]
35. Midoh, N. & Iwata, M. (1996) Plant Cell. Physiol. 37, 9–18. [PubMed]
36. Campbell, M. M. & Ellis, B. E. (1992) Phytochemistry 31, 737–742.
37. Rose, R., Weyand, M., Lammers, M., Ishizaki, T., Ahmadian, M. R. & Wittinghofer, A. (2005) Nature 435, 513–518. [PubMed]
38. Lei, M., Lu, W., Meng, W., Parrini, M. C., Eck, M. J., Mayer, B. J. & Harrison, S. C. (2000) Cell 102, 387–397. [PubMed]
39. Williams, J. G., Drugan, J. K., Yi, G. S., Clark, G. J., Der, C. J. & Campbell, S. L. (2000) J. Biol. Chem. 275, 22172–22179. [PubMed]
40. Leung, D. W. & Rosen, M. K. (2005) Proc. Natl. Acad. Sci. USA 102, 5685–5690. [PMC free article] [PubMed]
41. Potikha, T. S., Collins, C. C., Johnson, D. I., Delmer, D. P. & Levine, A. (1999) Plant Physiol. 119, 849–858. [PMC free article] [PubMed]
42. Torres, M. A. & Dangl, J. L. (2005) Curr. Opin. Plant Biol. 8, 397–403. [PubMed]
43. Mongrand, S., Morel, J., Laroche, J., Claverol, S., Carde, J. P., Hartmann, M. A., Bonneu, M., Simon-Plas, F., Lessire, R. & Bessoule, J. J. (2004) J. Biol. Chem. 279, 36277–36286. [PubMed]

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...