• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of pnasPNASInfo for AuthorsSubscriptionsAboutThis Article
Proc Natl Acad Sci U S A. Nov 8, 2005; 102(45): 16374–16378.
Published online Oct 28, 2005. doi:  10.1073/pnas.0501724102
PMCID: PMC1283414
Medical Sciences

Telomere length and heredity: Indications of paternal inheritance

Abstract

Cellular telomere length is linked to replicative life span. Telomere repeats are lost in peripheral blood cells in vivo by age, and women show less telomere attrition than men. Previous reports have indicated that telomere length and chromosome-specific telomere-length patterns partly are inherited. The mode of heredity has not been clarified, but a link to the X chromosome was recently suggested. We analyzed peripheral mononuclear cells from 49 unrelated families for telomere length using a real-time PCR method. Short-term cultured Epstein–Barr virus-transformed lymphoblasts from the same individuals (n = 130) were analyzed for ability to maintain telomere length and possible gender-linked inheritance. A statistically significant association between telomere lengths comparing father–son (P = 0.011, n = 20) and father–daughter (P = 0.005, n = 22) pairs was found. However, no correlation was observed between mother–daughter (P = 0.463, n = 23) or mother–son (P = 0.577, n = 18). The father–offspring correlation was highly significant (P < 0.0001), in contrast to mother–offspring (P = 0.361). Epstein–Barr virus cultures demonstrated in most cases telomere preservation inversely related to initial mononuclear cell telomere length with short telomeres displaying the most pronounced elongation. Telomere length is inherited, and evidence for a father-to-offspring heritage of this trait was obtained, whereas in vitro telomere length maintenance was found to be dependent on the initial telomere length.

Keywords: gender

Since the demonstration of an association between telomere length and replicative potential (16), telomere biology has been in focus for issues on cellular senescence and immortalization. In human replicating somatic cells, there is an inverse relationship between telomere length and age, in cell cultures as well as at the organism level in vivo, albeit with a large interindividual variation. A strong association exists between critically short telomeres and induction of a senescence program leading to irreversible cell-cycle arrest, although telomere shortening is not an absolute requirement for senescence induction (7). True immortalization requires telomere maintenance, usually executed by the activity of telomerase or more rarely through recombinatorial events, as in ALT (alternative lengthening of telomeres) cells. The telomere reduction observed in normal peripheral mononuclear cells (MNCs) has been estimated to be 14–80 base pairs (bp) per year with some differences between various blood cell types (813). Because women have been found to lose fewer repeats per year than men, a gender difference in telomere attrition rate in blood cells has been proposed (10, 14, 15). Peripheral blood cell telomere length also has been found to be associated with cardiovascular diseases such as hypertension, atherosclerosis, and heart failure (16).

Reports on monozygotic and dizygotic twins indicate that mean telomere length as well as chromosome-specific telomere-length patterns are in part inherited (17, 18). The mode of inheritance has not been clarified, but a report based on Southern blot analysis of peripheral blood cell DNA from multigenerational pedigrees suggested a linkage to the X chromosome (14). Significant associations of telomere lengths between mother–daughter, mother–son, and father–daughter, but not between father–son, were reported suggesting an X-linked inheritance. The authors speculated that this association could be due to the DKC1 gene located on the X chromosome and encoding the dyskerin protein, which is important for accumulation of the hTR component of telomerase. In contrast, recently a linkage between paternal, but not maternal, age at conception and telomere length of children was demonstrated by Unryn et al. (19), and a mechanism was suggested whereby paternal age affects telomere length through vertical transmission and that X-linked factors may serve to stabilize telomere length changes.

In the present work, we have investigated a possible gender-related inheritance of telomere length in a material from 49 unrelated families. In a large series of Epstein–Barr virus (EBV) transformed cultures from the same individuals, we also investigated whether the ability to maintain telomeres in vitro was inherited.

Materials and Methods

The study material was a part of a larger sample collection and consisted of 132 healthy individuals in 49 unrelated families living in northern Sweden. Peripheral MNCs were collected and divided in two parts. One part was frozen in DMSO, and the other part was EBV-transformed and cultured for 18–55 days (mean 33 days) whereafter viable lymphoblastoid cells were DMSO frozen. The study was approved by the local ethics committee, and participants gave written informed consent. The children (27 daughters and 22 sons) were from 32 to 42 (mean 37) years old, and the parents (41 mothers and 42 fathers) were between 52 and 86 (mean 66) years old.

DNA was extracted from peripheral MNCs and EBV-transformed cells by using standard procedures. Telomere length was examined by using a recently described real-time PCR method (8). In a separate study from our laboratory (20), this technique was shown to correspond significantly to Southern blot data (P < 0.001). Briefly, two 96-well plates were prepared for each experiment, one containing telomere primers and the other β2-globin (control gene) primers. Otherwise, the plates were identical concerning DNA amount, reagent concentrations, and sample order. To test the efficiency of each PCR reaction, a standard curve ranging from 0.3 to 5 ng/μl DNA was produced in every plate using the cell line CCRF-CEM. DNA from each individual and from reference DNA (CCRF-CEM) was diluted to ≈1.75 ng/ul, denatured at 95°C, chilled on ice, centrifuged at 730 × g, and tested in triplicates using 35 ng of DNA per well. Final concentrations of reagents were 1.25 units of AmpliTaq Gold DNA polymerase (Applied Biosystems), 150 nM 6-ROX (Molecular Probes), 0.2× SYBR Green 1 (Roche Diagnostics), 1% DMSO, 0.2 mM of each dNTP (MBI Fermentas, Amherst, NY), 5 mM DTT, 15 mM Tris·HCl (pH 8.0), 50 mM KCl, and 2 mM MgC2. The sequences (written 5′ to 3′) and final concentrations of the telomere and β2-globin (HBG) primers were as follows: Tel 1: GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT, 270 nM; Tel 2: TCCCGACTATCCCTATCCCTTCCCTATCCCTATCCCTA, 900 nM; HBG 1: GCTTCTGACACAACTGTGTTCACTAGC, 400 nM; and HBG 2: CACCAACTTCATCCACGTTCACC, 400 nM.

PCR amplification was performed in a PRISM 7000 sequence detection system (Applied Biosystems) using conditions as described by Cawthon (8) except that the number of cycles was increased to 35 for the telomere amplification and to 40 for the β2-globin amplification, i.e., the PCR will be more sensitive to detect eventual contaminations. sds v.1.1 software (Applied Biosystems) was used for construction of a standard curve and crossing point (Ct) values (see Figs. 4 and 5, which are published as supporting information on the PNAS web site). Telomere/single copy gene (T/S) values were calculated by the formula 2-ΔCt where equation M1. Relative T/S values were determined by dividing sample T/S values with the T/S value of reference DNA. To further reduce potential effects of interplate variability, family members were analyzed on the same plate.

Telomerase activity was measured by the TRAPeze method (TRAPeze Telomerase Detection Kit, Oncor) according to guidelines given by the supplier. The relative telomerase activity level was expressed as units of total product generated (TPG) corresponding to 0.5 μg of protein per assay. Statistical analysis was performed by using the statistical package for the social sciences v.12.0.1 (SPSS, Chicago). Correlations between the variables of interest were examined by Pearson correlation coefficients. To parse out the association between telomere lengths independent of age, we also calculated Pearson partial correlation, adjusting for corresponding age variables. All P values reported are not corrected for multiple testing. All individuals with relative T/S values outside the interquartile range were excluded from the data set to avoid effects of possible outliers.

Results

Telomere length declined by age as expected (r = -0.356; P < 0.0001; n = 132), corresponding to a loss of 21 bp per year (women 16 bp; men 25 bp) after transforming the relative T/S results to Southern blot data (20). Similar telomere attrition rates for men and women evaluated using Southern blot technique have been published previously (14, 19). The decrease in relative T/S units per year was 0.0068 for all individuals (women, 0.0052; men, 0.0082), corresponding very well to previously published data using the same PCR method (21). When analyzing children and parents separately, no telomere length change was found within the child group (age 32–42 years; Fig. 1A) in contrast to the parents (age 50–80 years; Fig. 1B), indicating a differential telomere loss during the life span.

Fig. 1.
Telomere length in relation to age in peripheral MNCs. (A) Children. (B) Parents.

MNC telomere length in samples from the mothers showed no correlation to the telomere length in MNCs from daughters (r = 0.161; P = 0.463; Fig. 2A) or sons (r = 0.141; P = 0.577; Fig. 2B). In contrast, there was a statistically significant correlation in telomere length comparing father–daughter (r = 0.578; P = 0.005; Fig. 2D) and father–son pairs (r = 0.558; P = 0.011; Fig. 2E). Furthermore, when comparing father–offspring pairs (daughters and sons), a highly significant association was demonstrated (r = 0.569; P < 0.0001; Fig. 2F), which was not found in mother–offspring pairs (r = 0.146; P = 0.361; Fig. 2C) or between spouses (r = 0.219; P = 0.207; data not shown). To control for potential age confounding effect, we also considered the results of Pearson partial correlation coefficients, adjusting for age of the subject and parental age at birth of the subject. The age-adjusted calculations did not change the statistical conclusion of the data (Table 1).

Fig. 2.
Intrafamilial relations for telomere length in peripheral MNCs. (A) Mother vs. daughter. (B) Mother vs. son. (C) Mother vs. children. (D) Father vs. daughter. (E) Father vs. son. (F) Father vs. children.
Table 1.
Age-adjusted interfamilial relationship

The coefficiency of variation within the triplicates in the PCR and between the relative T/S values of the same sample corresponded to 1.46% and 5.27%, respectively. In a twofold dilution, the coefficiency of variation was 4.7–13.8% depending on sample type. The efficiency of the PCR was 1.74–2.0 (mean 1.88) for the telomere and 1.91–2.07 (mean 1.99) for the β2-globin amplifications.

We next analyzed whether the telomere length of EBV cultures mirrored the original telomere length in MNCs and whether the ability of lymphocytes to maintain telomeres during in vitro culture could be inherited. The EBV-driven cells were harvested when the cell number was sufficient for freezing in DMSO (mean 33 days). The precise number of cell doublings was not counted, but because of the large number of individual cell cultures studied (n = 130), conclusions could be drawn regarding the telomere maintenance characteristics.

There was a statistically significant relationship between uncultured MNCs and EBV cultures regarding telomere lengths (r = 0.220; P = 0.012; Fig. 3A). Concerning in vitro induced differences, a majority of the cultures showed an increase in telomere length described as T/S values (median 0.37; range -0.44 to +2.67). If T/S data were transformed to Southern blot telomere restriction fragment values, the median increase of 0.37 T/S units corresponded to an increase in telomere length of ≈1.14 kbp (data not shown). Interestingly, the initial MNC telomere length was inversely correlated to change in telomere length with a high statistical significance (r = -0.246; P = 0.005; Fig. 3B). The ability to maintain telomere length in vitro was not dependent on gender or age (data not shown in figures).

Fig. 3.
Telomere length in EBV cultures. (A) Relation between telomere length in initial MNC preparation and after EBV-driven cell culture. (B) Change in telomere length during in vitro culture in relation to initial telomere length.

In 13 EBV cultures telomerase activity levels at the end of the culture period were determined showing a variation from 0 to 97.11 total product generated (TPG; mean = 33.16 TPG). There was a weak positive correlation between telomerase activity and telomere length changes in the cultures (r = 0.425); however, it was not statistically significant (P = 0.147).

Discussion

The present work addresses a suggested gender difference for the inheritance of telomere length and the ability to maintain telomere length in vitro. Contrary to the work of Nawrot et al. (14), indicating an X chromosome-linked inheritance, we found no obvious correlation between mothers and offspring regarding MNC telomere length in our material. Instead, there was a significant association between fathers and offspring, suggesting that paternal inheritance is a contributing factor for telomere length.

This discrepancy can be due to differences in the study materials used. Our material contained a maximum of three members from each unrelated family (mother, father, and child), minimizing the possibility for a bias due to confounding factors. Nawrot et al. (14) analyzed multigeneration pedigrees, but the number of persons in the individual families and their interrelationship was not reported. The method for telomere length estimation also could constitute a confounding factor. We used a recently described PCR-based technique (8), and with this approach only DNA sequences containing TTAGGG repeats are amplified, while also subtelomeric DNA segments are included in the Southern blot evaluations. It seems, however, unlikely that the lengths of subtelomeric DNA sequences are inherited in a way that the total effect would be a gender difference when analyzing telomere lengths by Southern blotting.

A positive association between paternal age and telomere length of children was recently shown by Unryn et al. (19) and could be explained by a previous observation indicating that sperm telomere length increases with age (3). These data support the significance of a father-linked inheritance pattern as demonstrated in the present work. We did not find a significant relationship between father age and telomere length of the children in our work (data not shown), which might be explained by the narrow age span of our children (32–42 years) compared with the Unryn et al. (19) material of “children” aged 30–80 years. A possibility is that the association found by Unryn et al. after compensation for age to a substantial extent might be based on the older part of the child group. Collected data indicate that telomere length is differentially maintained at different ages with a plateau at 30–50 years and an accelerated decrease thereafter and possibly a second plateau late in life (11, 14, 19, 22). The paternal relationship could hardly be due to a Y chromosome-linked mechanism because the father–daughter association was even stronger than for the father–son pairs.

The process of human aging has been suggested to be partly telomere-linked. This theory is supported by that fact that women have longer telomeres and live longer than men. Longevity seems to have a heritable component, and if a gender difference exists it would indirectly support a gender-linked inheritance of telomere length. However, studies on longevity and inheritance have not been conclusive in this respect (23).

The in vitro capacity to preserve telomeres was evaluated by analysis of 130 EBV-transformed lymphoblast cultures derived from the same MNC material, demonstrating a strong inverse correlation between telomere length change occurring during culture and telomere length at the initiation of culture. These data suggest that telomere elongation preferentially occurred on shorter telomeres, which is in agreement with observations in human hTERT-transfected fibroblast cells in vitro (24). In T lymphocytes transfection of dominant-negative hTERT led to loss of FISH-detectable telomere ends but no generalized telomere shortening suggesting a role for endogenous telomerase in maintaining critically short telomeres (25). Our data suggest a similar preference for elongation of short telomeres in B cells without forced expression of hTERT. In addition, a recent study on telomere length homeostasis in Saccharomyces cerevisiae showed that telomerase had an increasing preference for telomeres as their lengths declined, whereas the number of nucleotides added was telomere length independent (26). Peripheral blood B cells show ≈2-kbp-longer telomeres than T cells and monocytes (12). Our observation of 1.14-kbp (median value) longer telomeres in the cultured EBV transformed B cells compared with uncultured MNCs suggest a preservation of the original telomere length rather than a true elongation.

It could be hypothesized that the observed inheritance pattern is the result of genomic imprinting, which occurs when both maternal and paternal alleles are present, and one allele is expressed while the other remains inactive, giving a parent-of-origin gene expression pattern. Today >70 imprinted genes have been identified typically located in gene clusters (27), but no telomere length-regulating genes are yet known to be imprinted. The imprint marks distinguishing the parental alleles are epigenetic in nature and generally due to cytosine methylation, suggesting that the gene(s) of importance would be inactivated. However, of interest to note is that the hTERT gene promoter has been reported, as a rare exception, to be up-regulated by methylation (28, 29).

The telomere length in an individual cell is the net result of telomere shortening and lengthening activities. This balance is cell-type specific as illustrated by the fact that cell lines with permanent telomerase activity can have widely different telomere lengths varying from a few to >20 kbp. The homeostatic activities governing this length “tuning” are complex and only partly understood. A large number of interacting factors has been described, and recently a potential locus determining telomere length was reported (30). From the present study, it appears therefore that the ability to maintain telomere length in lymphocytes after mitogenic stimulation is primarily dependent on initial telomere length and not inheritance. Conversely, for the “telomere length tuning” homeostatic mechanism, a paternal inheritance must be considered as a contributing factor based on the results presented here. Together our in vivo and in vitro data studying cells from the same individuals are in good concordance with a study on twins showing that the relative lengths of individual telomeres are defined in the zygote and maintained during life (18).

In summary, telomere maintenance in vitro seemed telomere-length dependent with no gender-linked inheritance, while MNC telomere lengths demonstrated a paternal inheritance pattern.

Supplementary Material

Supporting Figure:

Acknowledgments

We thank David Roos and Ulla-Britt Westman for skillful technical assistance. This work was supported by grants from the Swedish Cancer Society, the Medical Faculty, Umeå University, and Lion's Cancer Research Foundation at Umeå University and by European Union Grant QLG1-1999-01341.

Notes

Author contributions: K.N., D.H., and G.R. designed research; K.N. and Å.L. performed research; K.N., P.L., D.H., and G.R. analyzed data; and K.N., P.L., D.H., and G.R. wrote the paper.

Conflict of interest statement: No conflicts declared.

This paper was submitted directly (Track II) to the PNAS office.

Abbreviations: EBV, Epstein–Barr virus; MNC, mononuclear cell; T/S, telomere/single copy gene.

References

1. Harley, C. B., Futcher, A. B. & Greider, C. W. (1990) Nature 345, 458-460. [PubMed]
2. Lindsey, J., McGill, N. I., Lindsey, L. A., Green, D. K. & Cooke, H. J. (1991) Mutat. Res. 256, 45-48. [PubMed]
3. Allsopp, R. C., Vaziri, H., Patterson, C., Goldstein, S., Younglai, E. V., Futcher, A. B., Greider, C. W. & Harley, C. B. (1992) Proc. Natl. Acad. Sci. USA 89, 10114-10118. [PMC free article] [PubMed]
4. Vaziri, H., Schachter, F., Uchida, I., Wei, L., Zhu, X., Effros, R., Cohen, D. & Harley, C. B. (1993) Am. J. Hum. Genet. 52, 661-667. [PMC free article] [PubMed]
5. Vaziri, H., Dragowska, W., Allsopp, R. C., Thomas, T. E., Harley, C. B. & Lansdorp, P. M. (1994) Proc. Natl. Acad. Sci. USA 91, 9857-9860. [PMC free article] [PubMed]
6. Allsopp, R. C., Chang, E., Kashefi-Aazam, M., Rogaev, E. I., Piatyszek, M. A., Shay, J. W. & Harley, C. B. (1995) Exp. Cell Res. 220, 194-200. [PubMed]
7. Ben-Porath, I. & Weinberg, R. A. (2004) J. Clin. Invest. 113, 8-13. [PMC free article] [PubMed]
8. Cawthon, R. M. (2002) Nucleic Acids Res. 30, e47. [PMC free article] [PubMed]
9. Frenck, R. W., Jr., Blackburn, E. H. & Shannon, K. M. (1998) Proc. Natl. Acad. Sci. USA 95, 5607-5610. [PMC free article] [PubMed]
10. Iwama, H., Ohyashiki, K., Ohyashiki, J. H., Hayashi, S., Yahata, N., Ando, K., Toyama, K., Hoshika, A., Takasaki, M., Mori, M., et al. (1998) Hum. Genet. 102, 397-402. [PubMed]
11. Brummendorf, T. H., Rufer, N., Holyoake, T. L., Maciejewski, J., Barnett, M. J., Eaves, C. J., Eaves, A. C., Young, N. & Lansdorp, P. M. (2001) Ann. N.Y. Acad. Sci. 938, 293-303. [PubMed]
12. Martens, U. M., Brass, V., Sedlacek, L., Pantic, M., Exner, C., Guo, Y., Engelhardt, M., Lansdorp, P. M., Waller, C. F. & Lange, W. (2002) Br. J. Haematol. 119, 810-818. [PubMed]
13. Robertson, J. D., Gale, R. E., Wynn, R. F., Dougal, M., Linch, D. C., Testa, N. G. & Chopra, R. (2000) Br. J. Haematol. 109, 272-279. [PubMed]
14. Nawrot, T. S., Staessen, J. A., Gardner, J. P. & Aviv, P. A. (2004) Lancet 363, 507-510. [PubMed]
15. Benetos, A., Okuda, K., Lajemi, M., Kimura, M., Thomas, F., Skurnick, J., Labat, C., Bean, K. & Aviv, A. (2001) Hypertension 37, 381-385. [PubMed]
16. Serrano, A. L. & Andres, V. (2004) Circ. Res. 94, 575-584. [PubMed]
17. Slagboom, P. E., Droog, S. & Boomsma, D. I. (1994) Am. J. Hum. Genet. 55, 876-882. [PMC free article] [PubMed]
18. Graakjaer, J., Pascoe, L., Der-Sarkissian, H., Thomas, G., Kolvraa, S., Christensen, K. & Londono-Vallejo, J. A. (2004) Aging Cell 3, 97-102. [PubMed]
19. Unryn, B. M., Cook, L. S. & Riabowol, K. T. (2005) Aging Cell 4, 97-101. [PubMed]
20. Grabowski, P., Hultdin, M., Karlsson, K., Tobin, G., Åleskog, A., Thunberg, U., Laurell, A., Sundström, C., Rosenquist, R. & Roos, G. (2005) Blood 105, 4807-4812. [PubMed]
21. Cawthon, R. M., Smith, K. R., O'Brien, E., Sivatchenko, A. & Kerber, R. A. (2003) Lancet 361, 393-395. [PubMed]
22. Yamaguchi, H., Calado, R. T., Ly, H., Kajigaya, S., Baerlocher, G. M., Chanock, S. J., Lansdorp, P. M. & Young, N. S. (2005) N. Engl. J. Med. 352, 1413-1424. [PubMed]
23. Cournil, A. & Kirkwood, T. B. (2001) Trends Genet. 17, 233-235. [PubMed]
24. Ouellette, M. M., Liao, M., Herbert, B. S., Johnson, M., Holt, S. E., Liss, H. S., Shay, J. W. & Wright, W. E. (2000) J. Biol. Chem. 275, 10072-10076. [PubMed]
25. Roth, A., Yssel, H., Pene, J., Chavez, E. A., Schertzer, M., Lansdorp, P. M., Spits, H. & Luiten, R. M. (2003) Blood 102, 849-857. [PubMed]
26. Teixeira, M. T., Arneric, M., Sperisen, P. & Lingner, J. (2004) Cell 117, 323-335. [PubMed]
27. Murphy, S. K. & Jirtle, R. L. (2003) BioEssays 25, 577-588. [PubMed]
28. Guilleret, I. & Benhattar, J. (2003) Exp. Cell Res. 289, 326-334. [PubMed]
29. Shin, K. H., Kang, M. K., Dicterow, E. & Park, N. H. (2003) Br. J. Cancer 89, 1473-1478. [PMC free article] [PubMed]
30. Vasa-Nicotera, M., Brouilette, S., Mangino, M., Thompson, J. R., Braund, P., Clemitson, J. R., Mason, A., Bodycote, C. L., Raleigh, S. M., Louis, E., et al. (2005) Am. J. Hum. Genet. 76, 147-151. [PMC free article] [PubMed]

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...