• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of aacPermissionsJournals.ASM.orgJournalAAC ArticleJournal InfoAuthorsReviewers
Antimicrob Agents Chemother. Feb 2002; 46(2): 438–442.
PMCID: PMC127053

Mutations Affecting the Rossman Fold of Isoleucyl-tRNA Synthetase Are Correlated with Low-Level Mupirocin Resistance in Staphylococcus aureus

Abstract

The isoleucyl-tRNA synthetase (ileS) gene was sequenced in toto from 9 and in part from 31 Staphylococcus aureus strains with various degrees of susceptibility to mupirocin. All strains for which the mupirocin MIC was greater than 8 μg/ml contained point mutations affecting the Rossman fold via Val-to-Phe changes at either residue 588 (V588F) or residue 631 (V631F). The importance of the V588F mutation was confirmed by an allele-specific PCR survey of 32 additional strains. Additional mutations of uncertain significance were found in residues clustered on the surface of the IleS protein.

Mupirocin is a topical antibiotic used to eliminate nasal carriage of Staphylococcus aureus and is particularly important in the control of methicillin-resistant S. aureus (3, 8). Mupirocin is in part an analogue of isoleucine and exerts its antimicrobial effect by irreversibly and specifically binding to bacterial isoleucyl-tRNA synthetase (IleS) and hence abolishing protein synthesis (9). IleS belongs to the class I tRNA synthetases, which are characterized by an ATP-binding Rossman fold containing conserved HMGH and KMSKS motifs (4).

High-level (MIC ≥ 512 mg liter−1) and low-level (MIC = 8 to 256 mg liter−1) mupirocin resistances have been described (5, 6) and appear to result from different mechanisms. High-level resistance existed prior to the clinical use of mupirocin (14) and results from acquisition of a new gene, mupA, encoding a second, novel staphylococcal isoleucyl-tRNA synthetase (7). Low-level resistance is more common (3, 8) and is thought to arise from point mutations within the usual chromosomal staphylococcal isoleucyl-tRNA synthetase gene (ileS). However, as the identity of these mutations was unclear, we undertook a study of ileS sequences from low-level-mupirocin-resistant strains.

MATERIALS AND METHODS

Bacterial strains and sensitivity testing.

Seventy-three epidemiologically unrelated S. aureus isolates from Europe and North America were investigated (Table (Table11 and and2).2). These included 25 mupirocin-susceptible isolates, 45 clinical isolates with low-level resistance, 2 laboratory-derived isolates with low-level resistance, and 1 clinical isolate with high-level resistance. MICs were determined in duplicate by the agar dilution method (15) with a positive control strain for which the MIC is known (64 μg/ml). Mupirocin powder was a gift from SmithKline Beecham Pharmaceuticals (Epsom, United Kingdom).

TABLE 1.
S. aureus strains surveyed by allele-specific PCR and partial ileS sequencing
TABLE 2.
Mutations in completely sequenced ileS genes from resistant strains

Mupirocin resistance training.

To isolate spontaneous mupirocin-resistant mutants, cultures of S. aureus Oxford NCTC6571 were flooded in triplicate onto Iso-Sensitest agar containing 8 μg of mupirocin per ml. The inoculated plates were dried and incubated for 48 h at 37°C. Mutants were confirmed as S. aureus with API kits (API, Hampshire, United Kingdom). The MICs for each mutant were determined by the agar dilution method (15). The three mutants for which MICs were 8 μg/ml were subcultured onto Iso-Sensitest agar plates containing increments of mupirocin ranging from 16 to 128 μg/ml and incubated at 37°C for 48 h.

DNA isolation and PCR amplification of the KMSKS region.

Genomic DNA was isolated by the guanidinium isothiocyanate and chloroform extraction method (2). Oligonucleotide primers ileS1601U (5" AAA GAG AAG CGA AAG ACT TAC TAC CAG 3") and ileS2365L (5" TAT GAC GAA GTT GTT AGC ACC AAT CTT 3"), flanking the gene fragment encoding the KMSKS region, were designed from the S. aureus ileS gene (GenBank accession no. X74219) to amplify a 764-bp fragment from 30 strains (Table (Table1).1). Asymmetric PCRs were performed with 3 pmol of nonbiotinylated ileS2365L primer per μl, 1 pmol of biotinylated ileS1490U primer per μl, 200 μM concentrations of each deoxynucleoside triphosphate (Pharmacia, Herts, United Kingdom), 100 ng of S. aureus genomic DNA, 1.5 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl, 0.1% (vol/vol) Triton X-100, 0.01% (wt/vol) gelatin, and 2.5 U of Taq DNA polymerase (Ampligene, Liverpool, United Kingdom) in a 100-μl reaction volume. PCR was performed with 30 cycles of denaturation at 94°C for 1 min, annealing at 52°C for 1 min, and extension at 72°C for 1 min. Reaction products were analyzed on 1.2% agarose gels. Biotinylated templates for sequencing were purified by using streptavidin-coated magnetic beads (Dynal, Liverpool, United Kingdom).

Allele-specific PCR.

Once a point mutation implicated in low-level mupirocin resistance was detected (a G-to-T transition at position 1762), an allele-specific primer containing the 3"-terminal nucleotide from the mutant allele was designed. To increase the specificity of the PCR assay, a mismatch was introduced at the 3" penultimate position (10), replacing a T with a C. The allele-specific primer mupLR (TAAATTCTTACTTTCTCATGGTTTCT) thus contained one mismatch with the mutant allele and a double mismatch with the wild type. When combined with the ileS1601U primer, the allele-specific primer amplified a 603-bp amplicon only from the mutant allele. To confirm that negative PCR results with the ileS1601U/mupLR primer pair were not the results of inhibitors or mistakes in setting up the reactions, a third primer, ileS2363L, was added to each reaction. Thus, in all successful PCRs the ileS1601U/ileS2363L primer pair amplified the fragment encoding the KMSKS region (764 bp) as an internal control, whereas the 603-bp product was obtained only when the mutant allele was present. PCRs were performed with 1 pmol each of ileS1601U, ileS2363L, and mupLR primers per μl. The PCR conditions were as described above.

PCR amplification of the entire ileS gene.

Primer pair ileS54L (5" GAG CAA TCG TCC CTT TTA 3") and ileS2798U (5" TTC ATC AAC AGC ACC AAG 3") were designed to amplify the entire coding sequence of the S. aureus ileS gene (1). PCR were performed as described above using 1 pmol each of ileS54L and ileS2797U primers per μl. The cycling conditions were 30 cycles of denaturation at 94°C for 1 min, annealing at 55°C (minus 0.25°C/cycle) for 1 min, and extension at 72°C for 1 min. PCR products were purified with a QIAquick-spin PCR purification kit (Qiagen, Sussex, United Kingdom).

DNA sequencing and computer analysis.

PCR templates were sequenced directly on both strands with nested primers using the PRISM Ready Reaction DyeDeoxy Terminator cycle sequencing kit and analyzed on an ABI 373 automated DNA sequencer according to the manufactures' instructions (Perkin-Elmer Ltd., Warrington, United Kingdom). Sequence analysis and multiple alignments were performed with GeneJockey II software (Biosoft, Cambridge, United Kingdom).

RESULTS

Mupirocin resistance training.

Three single-step mutants of S. aureus Oxford NCTC 6571 resistant to a low level of mupirocin (MIC equal to 8 μg/ml) were isolated at a frequency of 10−9 per CFU plated. Subculturing of mutants with low-level mupirocin resistance for which MICs were 8 μg/ml on increasing concentrations of mupirocin yielded two mutants (MA1, and MA2) (Table (Table1)1) for which MICs were >32 μg/ml at a frequency of 10−9 mutants per CFU plated. The resistance frequency is similar to that previously reported for mupirocin (12).

Point mutation in the vicinity of the KMSKS region.

All PCRs were optimized until a single band with the expected size was obtained and then sequenced directly using nested primers. Examination of the ileS DNA sequences obtained from 30 S. aureus isolates (19 with low-level mupirocin resistance and 11 mupirocin-susceptible isolates) (Table (Table1)1) revealed a G-to-T transversion at position 1762 (G1762T) in the strains with low-level mupirocin resistance and in none of the susceptible strains. This substitution results in an amino acid change (V588F) at codon 588 from valine to phenylalanine (Table (Table2)2) seven amino acid residues upstream of the region encoding the evolutionarily conserved KMSKS motif.

Screening for the G1762T mutation.

To look for the G1762T mutation in a large collection of isolates, an allele-specific PCR was developed. Seventy-one S. aureus isolates with various degrees of mupirocin resistance were blindly assayed using the allele-specific primer pair MupLR/ileS2365. All isolates with low-level mupirocin resistance for which MICs were ≥8 μg/ml generated an allele-specific PCR product (603 bp) with the exception of SKB 20 (Fig. (Fig.1,lane1,lane 7). The fact that SKB 20, though phenotypically an isolate with low-level mupirocin resistance, does not exhibit the G1762T mutation shows that this mutation is not absolutely necessary for the development of low-level mupirocin resistance and that other mutations must be able to give rise to the same phenotype. To identify any other mutations that might contribute to the resistance phenotype, the entire ileS gene from nine S. aureus isolates with various degrees of mupirocin resistance was therefore sequenced.

FIG. 1.
Screening by allele-specific PCR for the G1762T (V588F) mutation. Lanes 1 to 19 show results for selected strains and isolates (from left to right: SCR856, SKB 22, SKB 7, SKB 11, SKB 22, SKB 13, SKB 20, SKB 23, SKB 3, SCR501, SKB 14, SKB 18, SKB 30, SKB ...

Sequencing of the entire ileS gene from 10 S. aureus isolates.

Comparison of ileS sequences from eight isolates with different degrees of mupirocin resistance, one mupirocin-susceptible isolate, and the published sequence (GenBank accession no. X74219) revealed a total of 31 substitutions. These substitutions included 9 missense mutations (Table (Table2)2) and 22 silent mutations (data not shown). All mupirocin-resistant isolates analyzed had more than one point mutation that resulted in an amino acid change (Table (Table2).2). Interestingly, the only resistant isolate, SKB 20, which lacked the G1762T (V588F) mutation possessed a similar mutation in a nearby residue (G1891T [V631F]). The one mutant (REF1198) with high-level resistance that we investigated possessed point mutations similar to those in the mutants with low-level resistance, suggesting that the two underlying resistance mechanisms (gene acquisition and chromosomal mutations) can coexist.

All the S. aureus strains analyzed, irrespective of their country of origin or the level of mupirocin resistance as determined by MIC, had a G nucleotide at position 2330 (Table (Table2).2). This is in contrast to the DNA sequence obtained from the S. aureus Oxford strain (1), which has an A nucleotide at this position. This substitution results in an amino acid change from glutamic acid to glycine (Table (Table22).

Structural analysis of amino acid mutations.

Although the mutations we found in isolates with low-level mupirocin resistance are distributed throughout the protein sequence (from positions 37 to 777), superimposition of these mutant residues on the crystal structure of S. aureus Oxford (PDB: 1ffy) (17) showed that they all cluster on the surface of the protein. The mutations at residues 588 and 631 (V to F in both cases) sit close together in the Rossman fold, near (14 Å from) the conserved KMSKS motif (residues 595 to 599) involved in locating the carboxylate moiety of mupirocin or the γ-phosphate of ATP.

As the N and C termini of IleS lie close together in the overall structure of the enzyme, several apparently scattered mutations (Y37S, F662I, and E777G) in fact lie in close proximity on the exterior surface of the cylindrical central “sausage” of the molecule, distal to the tRNA binding face. The CP1/Editing domain displays a number of mutations. Of these, A270S is on the “inner” face adjacent to the tRNA some 19 Å from the editing active site, which includes residues H392 and Y394 located on the protein towards the 3" end of the tRNA (13). In contrast, F212S, N213D, and N257D form a 5- by 15-Å patch on this domain on the outside, away from the tRNA molecule.

DISCUSSION

Previous studies on the mode of action of mupirocin, comparing sequences of resistant and wild-type bacterial isoleucyl-tRNA synthetases, have reported single-amino-acid changes in the vicinity of the KMSKS region in Escherichia coli (18) and Methanobacterium thermoautotrophicum (11). To identify mutations in the staphylococcal ileS gene involved in low-level mupirocin resistance, we thus concentrated our initial efforts on this region. Sequencing of amplified DNA encoding this region showed that 19 resistant strains (including two laboratory-derived mutants) possessed a mutation (G1762T) causing a Val-to-Phe substitution (V588F) just upstream of the KMSKS motif.

We then used allele-specific PCR on 32 additional isolates to show that this mutation was present in all 46 isolates for which MICs were ≥8 μg/ml except one (SKB 20) and in none of the 25 isolates for which MICs were ≤4 μg/ml. Although this G1762T mutation has been described before in staphylococcal isolates (16), a previous study failed—for reasons that are not clear—to detect such a stark correlation with low-level mupirocin resistance. The one strain, SKB 20, for which the MIC was ≥8 μg/ml but which lacked the G1762T (V588F) mutation possessed a similar mutation in a nearby residue (G1891T [V631F]).

We speculate, after scrutiny of the crystal structure of IleS complexed with its cognate tRNA and mupirocin, that the Val-to-Phe mutations V588F and V631F have equivalent and important effects on the emergence of low-level mupirocin resistance. Starting with V588F, we note that the branched aliphatic side chain of V588 is packed against the side chains of residues M65, L69, M596, W621, V631, and V633 to form a strongly hydrophobic pocket within the Rossman fold. The introduction of the much larger benzyl side chain of F588 in the interior of the protein would not be tolerated without disruption of this pocket. We suggest that the only way the side chain could be accommodated would be via torsional rotation around the phenylalanyl chi-1 bond, even though this would result in some extra degree of solvent exposure by the benzene ring (Fig. (Fig.2B).As2B).As can be seen from Fig. Fig.2,2, a direct consequence of this would be a van der Waals clash between the aromatic ring and the extended aliphatic portion of mupirocin. The V631F substitution is expected to have an effect similar to that of V588F, as the local fold is so critical to accommodating mupirocin. In particular, we speculate that rotation of the bulky F588 side chain towards the solvent-accessible surface could trigger local conformational changes leading to the loss of a V588 hydrogen bond to the mupirocin. Introducing both the V588F and V631F mutations into the native structure would lead to considerable disruption of the hydrophobic pocket in the Rossman fold, supporting our suspicion that these mutations are mutually exclusive.

FIG. 2.
Structure of IleS from S. aureus Oxford. Distribution of mutated residues in isolates showing mupirocin resistance. (A) Overall IleS structure showing bound tRNAIle and mupirocin (PDB:1ffy) (17). The backbone fold of IleS is shown as a ribbon, with individual ...

The contributions of the other seven mutations to mupirocin resistance are unlikely to be as direct as those of V588F and V631F. The effects of mutations in the editing domain are difficult to rationalize, as mupirocin is not expected to have any dealings with the editing site. More puzzling still are the three mutations (F212S, N213D, and N257D) that are close to neither the editing site nor the Rossman fold and are not even on any face of the molecule known to interact with ligands. These mutations could point to interaction with some as-yet-undiscovered molecule, may produce some effects on folding and stability at distant sites, or may simply represent functionally null polymorphisms present in low-level-mupirocin-resistant S. aureus. A fuller understanding of the structural basis of low-level mupirocin resistance will depend on solving several mutant IleS structures, particularly those harboring the V588F and V631F mutations complexed with mupirocin.

Acknowledgments

This research program was supported by The Joint Research Board of the Special Trustees of St Bartholomew's Hospital, London, United Kingdom.

We thank Liz Lawlor, Alison Chalker, and John Hodgson from SKB for providing mupirocin powder, isolates with low-level mupirocin resistance, and primers.

REFERENCES

1. Chalker, A. F., J. M. Ward, A. P. Fosberry, and J. E. Hodgson. 1994. Analysis and toxic overexpression in Escherichia coli of a staphylococcal gene encoding isoleucyl transfer-RNA synthetase. Gene 141:103-108. [PubMed]
2. Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:155-159. [PubMed]
3. Cookson, B. D. 1998. The emergence of mupirocin resistance: a challenge to infection control and antibiotic prescribing practice J. Antimicrob. Chemother. 41:11-18. [PubMed]
4. Eriani, G., M. Delarue, O. Poch, J. Gangloff, and D. Moras. 1990. Partition of tRNA synthetases into two classes based on mutually exclusive sets of sequence motifs. Nature 347:203-206. [PubMed]
5. Farmer, T. H., J. Gilbart, and S. W. Elson. 1992. Biochemical basis of mupirocin resistance in strains of Staphylococcus aureus. J. Antimicrob. Chemother. 30:587-596. [PubMed]
6. Gilbart, J., C. R. Perry, and B. Slocombe. 1993. High-level mupirocin resistance in Staphylococcus aureus: evidence for two distinct isoleucyl-tRNA synthetases. Antimicrob. Agents Chemother. 37:32-38. [PMC free article] [PubMed]
7. Hodgson, J. E., S. P. Curnock, K. G. Dyke, R. Morris, D. R. Sylvester, and M. S. Gross. 1994. Molecular characterization of the gene encoding high-level mupirocin resistance in Staphylococcus aureus J2870. Antimicrob Agents Chemother. 38:1205-1208. [PMC free article] [PubMed]
8. Hudson, I. R. 1994. The efficacy of intranasal mupirocin in the prevention of staphylococcal infections: a review of recent experience. J. Hosp. Infect. 27:81-98. [PubMed]
9. Hughes, J., and G. Mellows. 1980. Interaction of pseudomonic acid A with Escherichia coli B isoleucyl-tRNA synthetase. Biochem. J. 191:209-219. [PMC free article] [PubMed]
10. Jacobson, D. A., and T. Moskovits. 1991. Rapid, nonradioactive screening for activating ras oncogene mutations using PCR-primer introduced restriction analysis (PCR-PIRA). PCR Methods Appl. 1:146-148. [PubMed]
11. Jenal, U., T. Rechsteiner, P. Y. Tan, E. Buhlmann, L. Meile, and T. Leisinger. 1991. Isoleucyl-tRNA synthetase of Methanobacterium thermoautotrophicum Marburg: cloning of the gene, nucleotide sequence, and localization of a base change conferring resistance to pseudomonic acid. J. Biol. Chem. 266:10570-10577. [PubMed]
12. Maple, P. A. C., J. M. T. Hamilton-Miller, and W. Brumfitt. 1992. Comparison of the in-vitro activities of the topical antimicrobials azelaic acid, nitrofurazone, silver sulphadiazine and mupirocin against methicillin-resistant Staphylococcus aureus. J. Antimicrob. Chemother. 29:661-668. [PubMed]
13. Nureki, O., D. G. Dmitry, M. Tateno, A. Shimada, T. Nakama, S. Fukai, M. Konno, T. L. Hendrickson, P. Schimmel, and S. Yokoyama. 1998. Enzyme structure with two catalytic sites for double-sieve selection of substrate. Science 280:578-582. [PubMed]
14. Rahman, M., S. Connolly, W. C. Noble, B. Cookson, and I. Phillips. 1990. Diversity of staphylococci exhibiting high-level resistance to mupirocin. J. Med. Microbiol. 33:97-100. [PubMed]
15. Reeves, D. S. 1989. Antibiotic assays, p. 195-222. In P. M. Hawkey and D. A. Lewis (ed.), Medical bacteriology: a practical approach. Oxford University Press, Oxford, United Kingdom.
16. Schmitz, F. J., A. C. Fluit, E. Lindenlauf, S. Scheuring, and K. Kohrer. 2000. Molecular analysis of possible mechanisms coding for low-level mupirocin resistance in clinical S. aureus isolates. Eur. J. Clin. Microbiol. Infect. Dis. 19:649-650. [PubMed]
17. Silvian, L. F., J. Wang, and T. A. Steitz. 1999. Insights into editing from an Ile-tRNA synthetase structure with tRNAIle and mupirocin. Science 285:1074-1077. [PubMed]
18. Yanagisawa, T., J. T. Lee, H. C. Wu, and M. Kawakami. 1994. Relationship of protein structure of isoleucyl transfer-RNA synthetase with pseudomonic acid resistance of Escherichia coli: proposed mode of action of pseudomonic acid as an inhibitor of isoleucyl transfer RNA synthetase. J. Biol. Chem. 269:24304-24309. [PubMed]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links