![]() | ![]() |
Formats:
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2005 by The American Society of Human Genetics. All rights reserved. Genetic Heterogeneity in Rubinstein-Taybi Syndrome: Mutations in Both the CBP and EP300 Genes Cause Disease 1Center for Human and Clinical Genetics, Leiden University Medical Center, Sylvius Laboratory, Leiden, The Netherlands; 2Institute of Medical Genetics, University of Zurich, Zurich; 3Department of Metabolic Diseases and Clinical Genetics, Pediatric Hospital Giovanni XXIII, Bari, Italy; 4Department of Molecular and Human Genetics, Baylor College of Medicine, Houston; and 5Department of Clinical Genetics, Academic Medical Center, Amsterdam Address for correspondence and reprints: Dr. Dorien J. M. Peters, Center for Human and Clinical Genetics, LUMC, Sylvius Laboratory, Wassenaarseweg 72, 2333AL, Leiden, The Netherlands. E-mail: d.j.m.peters/at/lumc.nl Received October 14, 2004; Accepted January 21, 2005. This article has been cited by other articles in PMC.Abstract CREB-binding protein and p300 function as transcriptional coactivators in the regulation of gene expression through various signal-transduction pathways. Both are potent histone acetyl transferases. A certain level of CREB-binding protein is essential for normal development, since inactivation of one allele causes Rubinstein-Taybi syndrome (RSTS). There is a direct link between loss of acetyl transferase activity and RSTS, which indicates that the disorder is caused by aberrant chromatin regulation. We screened the entire CREB-binding protein gene (CBP) for mutations in patients with RSTS by using methods that find point mutations and larger rearrangements. In 92 patients, we were able to identify a total of 36 mutations in CBP. By using multiple ligation-dependent probe amplification, we found not only several deletions but also the first reported intragenic duplication in a patient with RSTS. We extended the search for mutations to the EP300 gene and showed that mutations in EP300 also cause this disorder. These are the first mutations identified in EP300 for a congenital disorder. Introduction Rubinstein-Taybi syndrome (RSTS [MIM 180849]) is a congenital disorder characterized by mental and growth retardation and a wide range of typical dysmorphic features. Facial dysmorphology includes down-slanted palpebral fissures, a broad nasal bridge, a beaked nose, and micrognathia. Particularly noticeable are the broad thumbs and broad big toes. In addition, patients with RSTS have an increased risk of tumor formation. Although various types of tumors have been described, there is an excess of tumors arising from developmental defects and tumors in brain or neural-crest cell–derived tissue (Miller and Rubinstein 1995). Mutations in the gene encoding the CREB-binding protein (CREBBP, also known as “CBP”), located on chromosome 16p13.3, were found to be responsible for causing the disorder (Petrij et al. 1995). The protein, CBP, serves as a transcriptional coactivator (Kwok et al. 1994). It has a transactivation domain but does not specifically bind to DNA. The name of the protein is based on the interaction with the CRE-binding protein (CREB); however, CBP interacts with a large number of other proteins as well. It is thought that CBP acts as an integrator of the signals from various pathways (Goodman and Smolik 2000). Transcription factors downstream from these pathways need to compete with each other for the limited amount of CBP available in the nucleus. The protein forms a physical bridge between the DNA-binding transcription factors and the RNA polymerase II complex. In addition, CBP has intrinsic histone acetyl transferase (HAT) activity (Bannister and Kouzarides 1996). By acetylating histones, CBP opens the chromatin structure at the locus that needs to be expressed, a process essential for gene expression. CBP is also capable of acetylating a large number of other proteins—for example, the transcription factor p53 (Gu and Roeder 1997). Although RSTS is considered to be an autosomal dominant disorder, patients with RSTS very rarely have children. Almost all mutations, therefore, occur de novo. The mutations found in patients vary from relatively large microdeletions, which remove the entire gene, to point mutations. In addition, five translocations and two inversions disrupting the gene have been reported (Petrij et al. 2000). The microdeletions that remove the entire gene indicate that haploinsufficiency is the ultimate cause of the syndrome. Presumably, at critical moments during development, the amount of CBP drops below a certain threshold because of the loss of one allele. How this loss of the allele actually causes the particular symptoms of RSTS, however, is unclear. Nevertheless, we know from studies of patients with missense mutations and splice-site mutations that affect only the HAT domain of CBP that a loss of HAT activity is sufficient to cause the syndrome (Murata et al. 2001; Kalkhoven et al. 2003). To elucidate the complete spectrum of mutations, we screened 92 patients with RSTS for point mutations, small deletions or insertions, and large deletions and duplications. Because we could not find mutations in the CBP gene in the majority of our patients, we assumed that the remaining patients have mutations in other genes. CBP shares homology with another protein, p300, which is encoded by the EP300 gene on chromosome 22q13.2 (Lundblad et al. 1995). Both proteins are particularly homologous at their binding sites for transcription factors, and p300 also has a HAT domain. Like CBP, it serves as a transcriptional coactivator. EP300 is therefore a likely gene candidate to screen, and, indeed, we found three mutations in our analysis of the gene. These are the first mutations found in EP300 for a congenital disorder, and, in addition, they prove that RSTS is a genetically heterogeneous disorder. Material and Methods The majority of DNA samples described in this study were sent to us by clinicians in the Netherlands and many other countries in the form of soluble genomic DNA from patients with a clinical diagnosis of RSTS. DNA from the remainder of the patients was isolated from peripheral blood in our laboratory by use of standard protocols. The study was reviewed by the institutional review board of the Leiden University Medical Center. Parents or guardians of patients provided oral or written consent for molecular studies. DNA from 92 patients was analyzed. The 92 patients included some patients who have been presented in previous publications: mutations affecting the HAT domain have been described by Kalkhoven et al. (2003), and an mRNA deletion in patient 127-2 was described by Petrij et al. (2000), although no genomic mutation was found. Sequence variants were checked using a set of 98 control chromosomes. When possible, DNA from the parents of patients was analyzed to determine whether sequence variants occurred de novo. Denaturing Gradient Gel Electrophoresis (DGGE) DGGE was performed with a GC clamp on either the forward or the reverse primer (see table A1 [online only]). To screen the splice sites and branch sites, primers were selected to anneal to the flanking intron sequences and were chosen by use of either WINMELT (Biorad) or MELT-INGENY (Ingeny B.V.) software. All oligonucleotides were synthesized by Sigma-Aldrich. Amplified fragments were analyzed on 9% polyacrylamide gels (acrylamide:bisacrylamide, 37.5:1), with various linear denaturing gradients, optimized for each fragment, on the DCode system from Biorad. Gels were run at 90 V at a constant temperature of 60°C. An acrylamide mixture with 40% formamide and 7 M urea was defined as 100% denaturant, and acrylamide without these denaturing agents was defined as 0% denaturant. SSCP Analysis Electrophoresis was performed at room temperature by use of two types of gels. The first type was a polyacrylamide gel (acrylamide:bisacrylamide, 49:1) with 1 × Tris borate EDTA (TBE) without glycerol, and the second type was 0.5 × Mutation Detection Enhancement (National Diagnostics) with 0.6 × TBE and 10% glycerol. During amplification, the fragments for SSCP analysis were radioactively labeled, either by incorporation of α32P-dCTP or by use of primers that were phosphorylated using γ32P-dATP (Amersham). Visualization of the fragments was done using the PhosphorImager (Molecular Dynamics). Multiple Ligation-Dependent Probe Amplification Probes were designed for 20 exons of the CBP and EP300 genes. Multiple ligation-dependent probe amplification (MLPA) was performed as described by White et al. (2004); however, for some samples, the amplifications with the multiplex amplifiable probe hybridization (MAPH) and MLPA primers were performed in separate reactions. All samples in which rearrangements were found were tested at least twice. Sequencing and Restriction Digestions Sequencing was performed on the ABI 3700 from Applied Biosystems by use of the manufacturer's standard protocol and reagents. Restriction digestions were performed in accordance with the instructions of the manufacturer. Digestions or second sequencing reactions to confirm the first results were done on PCR fragments generated in an independent reaction. The deletion of 8 nt in patient 256-1 was confirmed by PCR with an allele-specific primer, TCCTCCATCTACTAGTAGTG, that skips the deleted part and anneals with two nucleotides after the deletion. The reverse primer has the sequence GTCCTAACCAAATCAAACAG. Results Point Mutations and Small Deletions or Insertions in CBP We screened the entire CBP gene for point mutations and small deletions or insertions, primarily by using DGGE, and screened target sequences that were not suited for DGGE by using SSCP analysis. The complete coding sequence and splice sites of the CBP gene required a total of 49 fragments, of which 40 were screened using DGGE, which covered ~83% of the coding sequence. Direct sequencing was used to identify the mutation after aberrant bands were found on DGGE or SSCP gels. All mutations were confirmed either by digestion with restriction enzymes, when a restriction-enzyme site was altered, or by a second sequence analysis. In 92 patients, we found a total of 27 mutations (table 1). The majority is predicted to lead to a premature translation stop, but we also detected five putative missense mutations. Base substitutions leading to a premature stop codon, as well as deletions and insertions leading to frame shifts, can be clearly identified as disease-causing mutations. On the other hand, a change of amino acids is much less clear; however, patients with RSTS, as a rule, have de novo mutations. Since we were able to confirm three of the mutations as de novo, we consider them the most likely to be disease causing. We do not have parental DNA for patients 228-1 and 260-1. All putative missense mutations are at the highly conserved HAT domain of CBP, and the amino acids that are changed have residues that are conserved in both the mouse and the fruit fly (fig. 1
Unless we have an RNA sample from a patient, we cannot check whether a splice-site mutation actually leads to aberrant splicing. These mutations, however, should also comply with the rule that mutations in patients with RSTS occurred de novo. Except for the mutation in patient 39-1, for which parental DNA was not available, we could confirm the mutations in that way. The G→A mutation in the splice-donor site flanking exon 24 in patient 39-1, however, is at the first position, which—in all splice-donor sites, without exception—should be a guanine. The splice-site mutation in patient 211-3 could be analyzed on RNA isolated from a cell line. Subsequent sequence analysis proved that the mutation in the splice-acceptor site flanking exon 22 leads to a deletion of exon 22 in the processed mRNA (Kalkhoven et al. 2003) Large Deletions and Duplications in CBP Previous research suggests that ~10% of the mutations in patients with RSTS are microdeletions affecting the CBP gene (Bartsch et al. 1999; Blough et al. 2000). We performed a FISH analysis using five cosmids spanning the entire gene to detect such deletions, when metaphase chromosome spreads of patients were available (Petrij et al. 2000). The recently developed technique of MLPA can also be used to detect microdeletions in soluble genomic DNA (Schouten et al. 2002). Because that was the type of material available to us for the majority of our patients, we performed MLPA to test the CBP gene. The resolution of MLPA is related to the number of probes used. We made a set of 20 MLPA probe pairs, covering most of the CBP gene. This allows us to screen for deletions that cannot be detected by FISH. Southern blotting could have been an alternative but is, in our case, impractical—if not impossible—because it requires so much DNA. The quality of DNA is slightly more critical for MLPA than for a normal PCR; therefore, we could not screen all patients with MLPA who were screened with DGGE and SSCP. In total, we screened 53 patients, and, for controls, we used material from 3 patients with known microdeletions that were detected using FISH, including 1 patient with a deletion of the entire CBP gene. Our MLPA analysis detected those positive controls flawlessly, and we found a number of previously undetected mutations. We found a total of nine new deletions, which ranged from single-exon deletions to the deletion of the entire gene. One deletion, that of exon 2, has been described elsewhere for the RNA level (Petrij et al. 2000). At the time, Southern blots did not reveal a deletion in the genomic DNA; therefore, it was not clear whether this was a genomic deletion or a splicing aberration. This mutation has been found in family 127, which consists of an affected mother and child, one of the very few cases of inherited RSTS. In addition to the nine deletions, we also found a duplication in one individual. Patient 162-1 has a duplication of the first exon of the CBP gene. How this leads to the inactivation of this allele is not clear, but a disease-causing duplication of the first exon has been described in Opitz syndrome (Winter et al. 2003). The exon 1 deletions and duplication were confirmed using extra probe pairs—one probe at the promoter region and three probe pairs in intron 1 (see table A2 [online only]). Mutations in EP300 Point-mutation detection and MLPA analysis of CBP yielded a total of 36 mutations in 92 patients, strongly suggesting that other genes could also be involved in RSTS. The most likely candidate is the EP300 gene, coding for p300, on chromosome 22q13.1. That gene was screened using the same approach. We used 37 DGGE fragments, which covered ~79% of the coding sequence of EP300, and the remaining part was covered by 10 SSCP fragments. MLPA was performed using a set of 20 exon-specific probe pairs. Indeed, three inactivating mutations were detected in the EP300 gene (fig. 2
Discussion We undertook a rigorous screening for point mutations, small deletions or insertions, and large deletions and duplications at the coding section of CBP by using genomic DNA from a large set of patients with RSTS. There is neither a predominant type of mutation nor a clear indication of a clustering of mutations within the CBP gene. If we take a look at missense mutations, however, we see that they are all situated in the HAT domain of CBP. We have published some of these mutations elsewhere and have shown that they affect the HAT activity of CBP (Kalkhoven et al. 2003). In addition, two articles each reported a de novo missense mutation in the HAT domain, clearly underpinning the importance of this domain in relation to the disorder (Murata et al. 2001; Bartsch et al. 2002). In contrast to our findings, a study by Coupry et al. (2002) reported four putative missense mutations of which only one was situated in the HAT domain. The sequence variations were not found in the other patients, and the affected residues were conserved in mouse and were therefore considered to be causative for RSTS. Whether these mutations actually arose de novo could not be confirmed. We have found mutations in less than half of the patients (~40%), which is comparable to the outcome of the study by Coupry et al. (2002). DGGE and SSCP analyses, together with detection of nucleotide substitutions, are capable of identifying only relatively small deletions and insertions. To detect larger deletions, we chose to perform MLPA for CBP and EP300. We now have shown that MLPA is capable of detecting deletions in the CBP gene that were previously identified by FISH. Because we have probe pairs corresponding to the majority of exons in both CBP and EP300, our MLPA screening also negates the need for Southern blotting. The use of MLPA has increased the power to detect mutations, enabling us to find smaller deletions than could be detected using FISH. Nevertheless, the combined analysis of our samples with both MLPA and DGGE or SSCP analysis found mutations in less than half of the patients. It is probable that some of the patients we screened will be regarded, upon closer clinical examination, as having a different syndrome that resembles RSTS; however, we think the majority of these patients may be considered as having true RSTS. Diagnosis of the syndrome has been performed by many clinicians, but we did not find that some have a significantly better record, in terms of the number of mutations found, than others. In addition, the set of patients with RSTS who were screened by Coupry et al. (2002) had been carefully ascertained, yet mutations were not found in more than half their patients as well. Either the CBP gene is mutated at parts that we did not screen, such as the promoter or other regulatory elements, or the mutations are in other genes. The unscreened parts of the CBP gene may harbor some mutations, but it is highly unlikely that they contain the majority of RSTS-related mutations that have not yet been identified in these patients. Indeed, RSTS is genetically heterogeneous, since we identified mutations in the EP300 gene. The finding of the EP300 mutations raises the question of whether there are phenotypic differences associated with EP300 mutations as compared with CBP mutations (fig. 3
Strikingly, the number of identified patients with RSTS who have EP300 mutations, currently three, is small compared with the number of identified patients with RSTS and CBP mutations (36 patients). Possibly, this ratio of 1:12 represents the different chances of mutations occurring in these two genes. Alternatively, the EP300 gene could have a mutation rate equal to that of the CBP gene, with the majority of mutation carriers not yet diagnosed as having RSTS. In view of this latter explanation, it is interesting that we found many more polymorphisms in the EP300 gene, including some that lead to amino acid changes (data not shown). Nevertheless, the majority of point mutations found in the CBP gene are likely to lead to truncated proteins, and two mutations in the EP300 gene are also predicted to truncate the protein, so it is unlikely that the mutation ratio can be entirely explain by differences in the genotype-phenotype relationship. Therefore, we think that the mutation rates of the loci are different. The CBP gene harbors an instable region around exon 2. This region was designated as instable because all translocation and inversion breakpoints could be found in all patients with RSTS, except one—as could all leukemia breakpoints for which CBP functions as a fusion partner. In addition, this same genomic piece of DNA proved very hard to clone at the time of positional cloning of the RSTS gene (Giles et al. 1997). The deletion of exon 2 and the deletions and duplication of exon 1 may be caused by this instable region. The instability in this region, however, cannot explain the majority of deletions found at the CBP locus, since most of these deletions have their breakpoints elsewhere (Petrij et al. 2000). Although CBP and p300 have been shown to have overlapping functions, there are subtle but clear differences between the two proteins (Kalkhoven 2004). During embryogenesis, CBP and EP300 have similar but not completely overlapping expression patterns (Partanen et al. 1999). In addition, experiments with F9 teratocarcinoma cell lines showed that retinoic acid signaling is p300 dependent and does not require CBP, whereas cAMP signaling depends on CBP and not p300 (Kawasaki et al. 1998; Ugai et al. 1999). Recent work with transgenic mice indicated the importance of the acetyl transferase function of p300 in myogenesis, but the acetyl transferase function of Cbp does not seem to be necessary for this process (Roth et al. 2003). The skeletal abnormalities found in heterozygous Cbp knockout mice have not been reported for heterozygous Ep300 knockout mice (Tanaka et al. 1997). We, however, do not find very striking phenotypical differences between patients with mutations in the EP300 gene versus the CBP gene. Double-heterozygous knockout mice for the Cbp and Ep300 genes resemble the homozygous knockout mice for either gene, in that all three types of mice die in utero, a finding which led to the idea that the combined levels of CBP and p300 are critical during development (Yao et al. 1998). Our findings support this hypothesis and reveal that even a relatively small decrease of either protein has significant developmental consequences. However, it is unclear how a decrease of either protein leads to the specific features of RSTS. Perhaps the partial loss of p300 is compensated for by recruitment of CBP, and subsequent depletion of CBP then leads to RSTS. Alternatively, both proteins could be involved in a common function, and, therefore, the total dosage would be required to prevent a syndrome like RSTS. If so, then this common function has a relationship with the HAT activity of the proteins because loss of only the HAT activity of CBP causes RSTS (Murata et al. 2001; Kalkhoven et al. 2003). Interestingly, there is a direct link between HAT activity and long-term memory. Heterozygous Cbp knockout mice have diminished mental capabilities. Experiments on these knockout mice revealed that inhibiting histone deacetyltransferase could ameliorate the problems with long-term memory seen in the mice (Alarcon et al. 2004). Transgenic mice with a dominant negative Cbp gene, in which only the HAT activity was ablated, also showed problems with long-term memory. Again, this could be reversed by a histone deacetylase inhibitor (Korzus et al. 2004). In view of these data, it is possible that other proteins with HAT activity—or with a function coupled to HAT activity—may also be involved in RSTS. After all, the three mutations we have found in the EP300 gene, together with the CBP gene mutations, still leave us with more than half of the cases of RSTS unaccounted for. Acknowledgments We thank the patients and their parents for their cooperation. We thank S. Trompet, for technical assistance, and Dr. P. de Knijff, for genotyping the families. Furthermore, we thank Dr. R. Carrozzo for clinical assistance. This work was funded by grants from the Dutch Cancer Society (RUL2000-2218), the Netherlands Organisation for Scientific Research (NWO) (912-04-047), and the Center of Medical System Biology, established by the Netherlands Genomics Initiative/NWO. Appendix A Table A1 Primers used in DGGE or SSCP analysis
aThe primer fragments used at the CBP gene have “CBP” in their name, followed by the exon number for which they are used, and the EP300 primers have “EP300” in their name. For the fragment names, exons that were split into several PCR fragments are denoted as a, b, etc. This has been done for exons that were either too large or had to be split to make fragments with single melting domains, which is crucial in DGGE. bGC clamps of 60 nt and 55 nt were used. Primers with a GC clamp are denoted as “GC55” or “GC60,” followed by the annealing sequence of the primer. Some fragments have a GC clamp at both ends. For example, the CBP exon 8 primers have a 55-nt GC clamp at the forward primer and a 12-nt GC clamp at the reverse primer. GC55 = CGCCCGCCGC GCCCCGCGCC CGGCCCGCCG CCCCCGCCCG CGCCCCCGGC CCGGG; GC60 = CGCCCGCCGC GCCCCGCGCC CGGCCCGCCG CCCCCGCCCG CGCCCGCCGC GCCCCGCGCC. cFor all DGGE fragments, we have listed the gradients that we used, and the SSCP fragments are denoted “SSCP” in this column. Table A2 Sequences of the Probes Used in the MLPA[Note]
Note.— The probes are listed separately for each locus in this table. Only the annealing sequences are given here. Each probe also contains a universal primer sequence (White et al. 2004). Electronic-Database Information Accession numbers and URLs for data presented herein are as follows: GenBank, http://www.ncbi.nlm.nih.gov/Genbank/ (for nucleotide sequences [accession numbers NM_004380 and NM_001429.1]). Online Mendelian Inheritence in Man (OMIM), http://www.ncbi.nlm.gov/Omim/ (for RSTS). References Alarcon JM, Malleret G, Touzani K, Vronskaya S, Ishii S, Kandel ER, Barco A (2004) Chromatin acetylation, memory, and LTP are impaired in CBP+/− mice: a model for the cognitive deficit in Rubinstein-Taybi syndrome and its amelioration. Neuron 42:947–959 [PubMed] Bannister AJ, Kouzarides T (1996) The CBP coactivator is a histone acetyltransferase. Nature 384:641–643 [PubMed] Bartsch O, Locher K, Meinecke P, Kress W, Seemanova E, Wagner A, Ostermann K, Rodel G (2002) Molecular studies in 10 cases of Rubinstein-Taybi syndrome, including a mild variant showing a missense mutation in codon 1175 of CREBBP. J Med Genet 39:496–501 [PubMed] Bartsch O, Wagner A, Hinkel GK, Krebs P, Stumm M, Schmalenberger B, Bohm S, Balci S, Majewski F (1999) FISH studies in 45 patients with Rubinstein-Taybi syndrome: deletions associated with polysplenia, hypoplastic left heart and death in infancy. Eur J Hum Genet 7:748–756 [PubMed] Blough RI, Petrij F, Dauwerse JG, Milatovich-Cherry A, Weiss L, Saal HM, Rubinstein JH (2000) Variation in microdeletions of the cyclic AMP-responsive element-binding protein gene at chromosome band 16p13.3 in the Rubinstein-Taybi syndrome. Am J Med Genet 90:29–34 [PubMed] Coupry I, Roudaut C, Stef M, Delrue MA, Marche M, Burgelin I, Taine L, Cruaud C, Lacombe D, Arveiler B (2002) Molecular analysis of the CBP gene in 60 patients with Rubinstein-Taybi syndrome. J Med Genet 39:415–421 [PubMed] den Dunnen JT, Antonarakis SE (2001) Nomenclature for the description of human sequence variations. Hum Genet 109:121–124 [PubMed] Giles RH, Petrij F, Dauwerse HG, den Hollander AI, Lushnikova T, van Ommen GJ, Goodman RH, Deaven LL, Doggett NA, Peters DJ, Breuning MH (1997) Construction of a 1.2-Mb contig surrounding, and molecular analysis of, the human CREB-binding protein (CBP/CREBBP) gene on chromosome 16p13.3. Genomics 42:96–114 [PubMed] Goodman RH, Smolik S (2000) CBP/p300 in cell growth, transformation, and development. Genes Dev 14:1553–1577 [PubMed] Gu W, Roeder RG (1997) Activation of p53 sequence-specific DNA binding by acetylation of the p53 C-terminal domain. Cell 90:595–606 [PubMed] Kalkhoven E (2004) CBP and p300: HATs for different occasions. Biochem Pharmacol 68:1145–1155 [PubMed] Kalkhoven E, Roelfsema JH, Teunissen H, den Boer A, Ariyurek Y, Zantema A, Breuning MH, Hennekam RC, Peters DJ (2003) Loss of CBP acetyltransferase activity by PHD finger mutations in Rubinstein-Taybi syndrome. Hum Mol Genet 12:441–450 [PubMed] Kawasaki H, Eckner R, Yao TP, Taira K, Chiu R, Livingston DM, Yokoyama KK (1998) Distinct roles of the co-activators p300 and CBP in retinoic-acid-induced F9-cell differentiation. Nature 393:284–289 [PubMed] Korzus E, Rosenfeld MG, Mayford M (2004) CBP histone acetyltransferase activity is a critical component of memory consolidation. Neuron 42:961–972 [PubMed] Kwok RP, Lundblad JR, Chrivia JC, Richards JP, Bachinger HP, Brennan RG, Roberts SG, Green MR, Goodman RH (1994) Nuclear protein CBP is a coactivator for the transcription factor CREB. Nature 370:223–226 [PubMed] Lundblad JR, Kwok RP, Laurance ME, Harter ML, Goodman RH (1995) Adenoviral E1A-associated protein p300 as a functional homologue of the transcriptional co-activator CBP. Nature 374:85–88 [PubMed] Miller RW, Rubinstein JH (1995) Tumors in Rubinstein-Taybi syndrome. Am J Med Genet 56:112–115 [PubMed] Murata T, Kurokawa R, Krones A, Tatsumi K, Ishii M, Taki T, Masuno M, Ohashi H, Yanagisawa M, Rosenfeld MG, Glass CK, Hayashi Y (2001) Defect of histone acetyltransferase activity of the nuclear transcriptional coactivator CBP in Rubinstein-Taybi syndrome. Hum Mol Genet 10:1071–1076 [PubMed] Partanen A, Motoyama J, Hui CC (1999) Developmentally regulated expression of the transcriptional cofactors/histone acetyltransferases CBP and p300 during mouse embryogenesis. Int J Dev Biol 43:487–494 [PubMed] Petrij F, Dauwerse HG, Blough RI, Giles RH, van der Smagt JJ, Wallerstein R, Maaswinkel-Mooy PD, van Karnebeek CD, van Ommen GJ, van Haeringen A, Rubinstein JH, Saal HM, Hennekam RC, Peters DJ, Breuning MH (2000) Diagnostic analysis of the Rubinstein-Taybi syndrome: five cosmids should be used for microdeletion detection and low number of protein truncating mutations. J Med Genet 37:168–176 [PubMed] Petrij F, Giles RH, Dauwerse HG, Saris JJ, Hennekam RC, Masuno M, Tommerup N, van Ommen GJ, Goodman RH, Peters DJ, Breuning MH (1995) Rubinstein-Taybi syndrome caused by mutations in the transcriptional co-activator CBP. Nature 376:348–351 [PubMed] Roth JF, Shikama N, Henzen C, Desbaillets I, Lutz W, Marino S, Wittwer J, Schorle H, Gassmann M, Eckner R (2003) Differential role of p300 and CBP acetyltransferase during myogenesis: p300 acts upstream of MyoD and Myf5. Embo J 22:5186–5196 [PubMed] Schouten JP, McElgunn CJ, Waaijer R, Zwijnenburg D, Diepvens F, Pals G (2002) Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification. Nucleic Acids Res 30:e57 [PubMed] Tanaka Y, Naruse I, Maekawa T, Masuya H, Shiroishi T, Ishii S (1997) Abnormal skeletal patterning in embryos lacking a single Cbp allele: a partial similarity with Rubinstein-Taybi syndrome. Proc Natl Acad Sci USA 94:10215–10220 [PubMed] Ugai H, Uchida K, Kawasaki H, Yokoyama KK (1999) The coactivators p300 and CBP have different functions during the differentiation of F9 cells. J Mol Med 77:481–494 [PubMed] White SJ, Vink GR, Kriek M, Wuyts W, Schouten J, Bakker B, Breuning MH, den Dunnen JT (2004) Two-color multiplex ligation-dependent probe amplification: detecting genomic rearrangements in hereditary multiple exostoses. Hum Mutat 24:86–92 [PubMed] Winter J, Lehmann T, Suckow V, Kijas Z, Kulozik A, Kalscheuer V, Hamel B, Devriendt K, Opitz J, Lenzner S, Ropers HH, Schweiger S (2003) Duplication of the MID1 first exon in a patient with Opitz G/BBB syndrome. Hum Genet 112:249–254 [PubMed] Yao TP, Oh SP, Fuchs M, Zhou ND, Ch’ng LE, Newsome D, Bronson RT, Li E, Livingston DM, Eckner R (1998) Gene dosage-dependent embryonic development and proliferation defects in mice lacking the transcriptional integrator p300. Cell 93:361–372 [PubMed] |
PubMed related articles
Your browsing activity is empty. Activity recording is turned off. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Am J Med Genet. 1995 Mar 13; 56(1):112-5.
[Am J Med Genet. 1995]Nature. 1995 Jul 27; 376(6538):348-51.
[Nature. 1995]Nature. 1994 Jul 21; 370(6486):223-6.
[Nature. 1994]Genes Dev. 2000 Jul 1; 14(13):1553-77.
[Genes Dev. 2000]Nature. 1996 Dec 19-26; 384(6610):641-3.
[Nature. 1996]Cell. 1997 Aug 22; 90(4):595-606.
[Cell. 1997]J Med Genet. 2000 Mar; 37(3):168-76.
[J Med Genet. 2000]Hum Mol Genet. 2001 May 1; 10(10):1071-6.
[Hum Mol Genet. 2001]Hum Mol Genet. 2003 Feb 15; 12(4):441-50.
[Hum Mol Genet. 2003]Nature. 1995 Mar 2; 374(6517):85-8.
[Nature. 1995]Hum Mol Genet. 2003 Feb 15; 12(4):441-50.
[Hum Mol Genet. 2003]J Med Genet. 2000 Mar; 37(3):168-76.
[J Med Genet. 2000]Hum Mutat. 2004 Jul; 24(1):86-92.
[Hum Mutat. 2004]Hum Mol Genet. 2003 Feb 15; 12(4):441-50.
[Hum Mol Genet. 2003]Eur J Hum Genet. 1999 Oct-Nov; 7(7):748-56.
[Eur J Hum Genet. 1999]Am J Med Genet. 2000 Jan 3; 90(1):29-34.
[Am J Med Genet. 2000]J Med Genet. 2000 Mar; 37(3):168-76.
[J Med Genet. 2000]Nucleic Acids Res. 2002 Jun 15; 30(12):e57.
[Nucleic Acids Res. 2002]J Med Genet. 2000 Mar; 37(3):168-76.
[J Med Genet. 2000]Hum Genet. 2003 Mar; 112(3):249-54.
[Hum Genet. 2003]Hum Mol Genet. 2003 Feb 15; 12(4):441-50.
[Hum Mol Genet. 2003]Hum Mol Genet. 2001 May 1; 10(10):1071-6.
[Hum Mol Genet. 2001]J Med Genet. 2002 Jul; 39(7):496-501.
[J Med Genet. 2002]J Med Genet. 2002 Jun; 39(6):415-21.
[J Med Genet. 2002]J Med Genet. 2002 Jun; 39(6):415-21.
[J Med Genet. 2002]J Med Genet. 2002 Jun; 39(6):415-21.
[J Med Genet. 2002]Nature. 1995 Jul 27; 376(6538):348-51.
[Nature. 1995]Genomics. 1997 May 15; 42(1):96-114.
[Genomics. 1997]J Med Genet. 2000 Mar; 37(3):168-76.
[J Med Genet. 2000]Biochem Pharmacol. 2004 Sep 15; 68(6):1145-55.
[Biochem Pharmacol. 2004]Int J Dev Biol. 1999 Sep; 43(6):487-94.
[Int J Dev Biol. 1999]Nature. 1998 May 21; 393(6682):284-9.
[Nature. 1998]J Mol Med. 1999 Jun; 77(6):481-94.
[J Mol Med. 1999]EMBO J. 2003 Oct 1; 22(19):5186-96.
[EMBO J. 2003]Cell. 1998 May 1; 93(3):361-72.
[Cell. 1998]Hum Mol Genet. 2001 May 1; 10(10):1071-6.
[Hum Mol Genet. 2001]Hum Mol Genet. 2003 Feb 15; 12(4):441-50.
[Hum Mol Genet. 2003]Neuron. 2004 Jun 24; 42(6):947-59.
[Neuron. 2004]Neuron. 2004 Jun 24; 42(6):961-72.
[Neuron. 2004]Hum Mutat. 2004 Jul; 24(1):86-92.
[Hum Mutat. 2004]Hum Genet. 2001 Jul; 109(1):121-4.
[Hum Genet. 2001]Hum Mol Genet. 2003 Feb 15; 12(4):441-50.
[Hum Mol Genet. 2003]J Med Genet. 2000 Mar; 37(3):168-76.
[J Med Genet. 2000]