• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of ajhgLink to Publisher's site
Am J Hum Genet. Mar 2005; 76(3): 510–516.
Published online Jan 11, 2005. doi:  10.1086/428141
PMCID: PMC1196401

Identification of C7orf11 (TTDN1) Gene Mutations and Genetic Heterogeneity in Nonphotosensitive Trichothiodystrophy

Abstract

We have identified C7orf11, which localizes to the nucleus and is expressed in fetal hair follicles, as the first disease gene for nonphotosensitive trichothiodystrophy (TTD). C7orf11 maps to chromosome 7p14, and the disease locus has been designated “TTDN1” (TTDnonphotosensitive 1). Mutations were found in patients with Amish brittle-hair syndrome and in other nonphotosensititive TTD cases with mental retardation and decreased fertility but not in patients with Sabinas syndrome or Pollitt syndrome. Therefore, genetic heterogeneity in nonphotosensitive TTD is a feature similar to that observed in photosensitive TTD, which is caused by mutations in transcription factor II H (TFIIH) subunit genes. Comparative immunofluorescence analysis, however, suggests that C7orf11 does not influence TFIIH directly. Given the absence of cutaneous photosensitivity in the patients with C7orf11 mutations, together with the protein’s nuclear localization, C7orf11 may be involved in transcription but not DNA repair.

Trichothiodystrophy (TTD), or sulfur-deficient brittle hair (Price et al. 1980), can be associated with a spectrum of symptoms affecting organs of ectodermal and neuroectodermal origin (table 1). These include nail dystrophy, mental and growth retardation, ichthyosis, decreased fertility, and cutaneous photosensitivity, but not cancer (Bergmann and Egly 2001). Approximately half of patients with TDD display photosensitivity. These cases are associated with defects in nucleotide excision repair (NER) due to mutations in XPD (Botta et al. 1998), XPB (Weeda et al. 1997), or TTD-A (Giglia-Mari et al. 2004) that cause a reduction of cellular concentration of transcription factor II H (TFIIH) (Botta et al. 2002). However, the causal gene or genes for nonphotosensitive TTD are unknown.

Table 1
Clinical Features and C7orf11 Mutations in Patients with Nonphotosensitive TTD

Amish brittle-hair brain syndrome (ABHS [MIM 234050]) is an autosomal recessive disorder characterized by short stature, intellectual impairment, sulfur-deficient brittle hair, and decreased male fertility but not cutaneous photosensitivity (Jackson et al. 1974; Baden et al. 1976). Other forms of nonphotosensitive TTD, such as Sabinas brittle-hair syndrome (MIM 211390) (Howell et al. 1981) and Pollitt syndrome (MIM 275550) (Pollitt et al. 1968), were hypothesized to be allelic with ABHS, because of similar clinical presentations. Initially, to search for the ABHS disease locus, we performed homozygosity mapping on a subset of affected members from a consanguineous Amish kindred (Jackson et al. 1974) and identified a 2-Mb candidate locus on 7p14 (fig. 1A) (Seboun et al., in press). We then analyzed seven genes (fig. 1A) (Scherer et al. 2003; The Chromosome 7 Annotation Project [see Web site]) by DNA sequencing and identified three homozygous sequence variations in the affected members of family E (fig. 1C): a T→C variant in intron 7 of C7orf10, a G→A variant in exon 1 of CDC2L5 causing an arginine-to-lysine substitution (R21K), and an A→G variant in exon 2 of C7orf11 causing a methionine-to-valine substitution (M144V). The first two sequence variations were excluded from further analysis, because the same genotype was found in either normal controls or the unaffected parents in family E. We have shown elsewhere that C7orf11 encodes a 179-aa protein of unknown function (Nakabayashi et al. 2002) and that it is variably expressed in many tissues, including fibroblasts and brain. By sequencing all available members of the Amish kindred, we confirmed that all 13 affected cases were homozygous for the A→G variant and that 26 unaffected members were either heterozygous carriers (18/26) or homozygous for the normal allele (8/26) (fig. 1C and and11D). We genotyped 148 controls (296 chromosomes), including 48 unrelated Amish individuals, and confirmed cosegregation of the M144V variant in only carrier or disease chromosomes.

Figure  1
Identification of C7orf11 mutations. To screen the two exons and the 5′ upstream region of the C7orf11 gene, we used three sets of primer pairs: C7orf11-5upF/ex1R1, C7orf11ex1-F2/R3, and C7orf11ex2-F/R2 (for primer sequences, see table A1 [online ...

We then examined C7orf11 in 12 additional cases of nonphotosensitive TTD and found two deleterious homozygous deletions. In siblings of Moroccan origin with TTD (Przedborsk et al. 1990), we found a 2-bp homozygous deletion in exon 1 (nucleotides 187 and 188 of C7orf11 mRNA [GenBank accession number NM_138701]) (data not shown), which predicts a 57-aa truncated protein. In another case—an Italian patient with TTD and severe nervous-system impairment (patient 6474) (Rizzo et al. 1992)—our attempts to amplify the coding regions of C7orf11 failed. By multiplex PCR using a primer pair that amplifies a 704-bp control fragment, we determined that part of exon 1 and the entire exon 2 of C7orf11 were homozygously deleted, whereas the flanking genes (CDC2L5 and C7orf10) were not (fig. 1B and and11E). These patients with homozygous deletions are likely to be genetically null for C7orf11, which might explain their more-severe neurological phenotype in comparison with that of the patients with ABHS. We did not find any mutations in the two exons and 5′ upstream region of C7orf11 in the other 10 cases of nonphotosensitive TTD, including two cases of Sabinas syndrome and one case of Pollitt syndrome, which suggests that genetic heterogeneity exists in nonphotosensitive TTD. The fibroblasts derived from all but two patients with Sabinas syndrome were tested for UV sensitivity by use of various NER parameters, including unscheduled DNA synthesis, recovery from transcription inhibition, and overall clonogenic cell survival after UV exposure. Microsatellite analysis also excluded the 2-Mb C7orf11 locus from involvement in Sabinas syndrome. Therefore, we have designated C7orf11 with the symbol TTDN1 (TTD nonphotosensitive 1).

We identified predicted proteins with sequence similarity to human C7orf11 in six mammalian species as well as chicken, frog, fish, and insects, but not in lower eukaryotic species (C. elegans and yeast). The first two-thirds of the human C7orf11 protein is remarkably glycine/proline–rich (45% in 125 aa), and this feature is more evident in higher eukaryotic species (fig. 2A). There are two highly conserved regions: CR1, conserved from zebrafish to human, and CR2, conserved from mosquito to human (fig. 2A). The mutant M144V found in patients with ABHS is located in the three amino acid residues (SML) in CR2 that are conserved in all species. To examine the subcellular localization of C7orf11, we transfected Myc-epitope–tagged protein into cultured mammalian cells and found that it was predominantly expressed in the nucleus (fig. 2B); the pattern of the Myc-epitope–mutated protein was indistinguishable from the wild type (data not shown). We performed in situ RNA hybridization analysis for C7orf11 in human fetal skin tissue and found that it was expressed in epidermis and hair follicles, consistent with presentation of the phenotype (fig. 2C). C7orf11 expression was not clearly detected in dermis by in situ hybridization, but it was found by RT-PCR in fibroblast cells.

Figure  2
A, The human C7orf11 protein. The glycine/proline–rich region is shown in green (the low-complexity regions detected by the BLASTP program are in light green). There are two highly conserved C terminal regions (CR1 and CR2) among the candidate ...

To examine whether C7orf11 mutations affect TFIIH cellular concentration, we performed comparative immunofluorescence analysis, using antibody against the xeroderma pigmentosum group B protein (XPB) (a core component of TFIIH), and found that the TFIIH levels in normal controls and in fibroblasts from a patient with TTD (one of the Moroccan siblings with the 2-bp deletion) are the same (fig. 2D). This result, combined with the observation that mutations could not be detected in any of TFIIH subunits and with the genetic mapping data (not shown), suggests that the defect in nonphotosensitive TTD is independent of TFIIH action.

To our knowledge, C7orf11 is the first gene identified as mutated in patients with nonphotosensitive TTD. Since these mutations were found in only a subset of nonphotosensitive TTD cases, it is likely that there is more than one disease-causing gene, as was found for photosensitive TTD. Photosensitive TTD is caused by mutations in genes encoding subunits (XPD, XPB, and TTD-A) of the TFIIH complex that functions in transcription and DNA repair. Since there is an absence of cutaneous photosensitivity in the patients with C7orf11 mutations and since the protein demonstrates a nuclear localization, it is possible that C7orf11 may have a role in transcriptional processes but have no role in DNA repair. Moreover, the brittle hair observed in patients with TTD is thought to result from the reduced expression of high-sulfur proteins (intermediate keratin filaments and matrix proteins) in the late stage of keratinocyte differentiation (Bergmann and Egly 2001). Genes in these pathways and/or proteins associated with C7orf11 would be the primary candidates for involvement in other nonphotosensitive TTD cases.

Acknowledgments

We thank Alli Tallqvist for skillful technical assistance in RNA in situ hybridization experiments. We acknowledge The Centre for Applied Genomics, the Genome Canada/Ontario Genome Institute, the Hospital for Sick Children Foundation, the Association Française contre les Myopathies, and the Dykstra Foundation in Detroit (grant to C.E.J.). S.W.S. is an Investigator of the Canadian Institutes of Health Research, a Scholar of the McLaughlin Centre for Molecular Medicine, and an International Scholar of the Howard Hughes Medical Institute.

Appendix A

Table A1

Primer Sequences and Product Sizes

Sequence(5′→3′)
Primer Type and NumberPrimer NameForwardReverseProduct Size(bp)
Test:
 1C7orf10ex2-F/RTGTGGACTCCCTTGCTAAGAATGAAAAACCCAATCACCAAAATG217
 2C7orf10ex1-F/RGGCGAGAGACTCAGTGGATTATCCCTTTAGCCACCCAGAC403
 3C7orf11-5upF/ex1R1GTCTCAGATGGCATCGGTCGTTCTCCCACCGGAACTGTA413
 4C7orf11ex1-F2/R3GAACTGATGTGCCGTAGGGTAAGTAAGAGCTCGGCAAACG510
 5C7orf11intron-F/RCGTTTGCCGAGCTCTTACTTGCAAGTTGGAAAACCACGTA501
 6C7orf11ex2-F/R2CAATGTGATTCCCGCTAACCTCATACCACAAAACCACAATAGC627
 7C7orf11ex2-F3/R3GGTTCAAGTCACAACTTTTAAGCATCAAAGTCATCATCTTTGGGTAA412
 83′ds-F1/R1TGGCCATTTGGTTTGTTACCGCCCCTATAAGGAGACCCTCT604
 93′ds-F3/R3CCACTCACACATCCATGTCCCAAACAAAAGCCAAAGCAAA205
 103′ds-F4/R4TCCTTTCTTGCAGGCTTGATTTCTGAAAGAGCCAGCCAGT305
 11CDC2L5-3′UTR-F/RGAGTGAAGGCAGCCCTGTTAAAAAGGCAGAAGGCTGAGGT300
Control:
DJg5/g6AGCCAGGCCAGAGAACACTAGGGTCCTCCCTCTAGCCTTA704

Electronic-Database Information

Accession numbers and URLs for data presented herein are as follows:

The Chromosome 7 Annotation Project, http://www.chr7.org/ (for seven candidate genes on 7p14)
Ensembl, http://www.ensembl.org/ (for proteins fromchimpanzee [accession number ENSPTRP00000032652],rat [accession number ENSRNOP00000018746], and chicken [accession number ENSGALP00000020100])
GenBank, http://www.ncbi.nlm.nih.gov/Genbank/ (forhuman C7orf11 mRNA [accession number NM_138701] and cDNA sequences from zebrafish [accession number BC062385] and pig [accession number BP456435])
NCBI, http://www.ncbi.nlm.nih.gov/ (for human C7orf11 [accession number NP_619646] and orthologues from mouse [accession number BAB27916], frog [accession number NP_989025], pufferfish [accession number CAF91712], fruitfly [accession number NP_648690], and mosquito [accession number XP_318005])
Online Mendelian Inheritance in Man (OMIM), http://www.ncbi.nlm.nih.gov/Omim/ (for Amish brittle-hair syndrome, Sabinas syndrome, and Pollitt syndrome)
UCSC Genome Browser, http://genome.ucsc.edu/

References

Alfandari S, Delaporte E, van Neste D, Lucidarme-Delespierre E, Piette F, Bergoend H (1993) A new case of isolated trichothiodystrophy. Dermatology 186:197–200 [PubMed]
Baden HP, Jackson CE, Weiss L, Jimbow K, Lee L, Kubilus J, Gold RJ (1976) The physicochemical properties of hair in the BIDS syndrome. Am J Hum Genet 28:514–521 [PMC free article] [PubMed]
Bergmann E, Egly JM (2001) Trichothiodystrophy, a transcription syndrome. Trends Genet 17:279–286 [PubMed] [Cross Ref]10.1016/S0168-9525(01)02280-6
Botta E, Nardo T, Broughton BC, Marinoni S, Lehmann AR, Stefanini M (1998) Analysis of mutations in the XPD gene in Italian patients with trichothiodystrophy: site of mutation correlates with repair deficiency, but gene dosage appears to determine clinical severity. Am J Hum Genet 63:1036–1048 [PMC free article] [PubMed]
Botta E, Nardo T, Lehmann AR, Egly JM, Pedrini AM, Stefanini M (2002) Reduced level of the repair/transcription factor TFIIH in trichothiodystrophy. Hum Mol Genet 11:2919–2928 [PubMed] [Cross Ref]10.1093/hmg/11.23.2919
Giglia-Mari G, Coin F, Ranish JA, Hoogstraten D, Theil A, Wijgers N, Jaspers NG, Raams A, Argentini M, van der Spek PJ, Botta E, Stefanini M, Egly JM, Aebersold R, Hoeijmakers JH, Vermeulen W (2004) A new, tenth subunit of TFIIH is responsible for the DNA repair syndrome trichothiodystrophy group A. Nat Genet 36:714–719 [PubMed] [Cross Ref]10.1038/ng1387
Howell RR, Arbisser AI, Parsons DS, Scott CI, Fraustadt U, Collie WR, Marshall RN, Ibarra OC (1981) The Sabinas syndrome. Am J Hum Genet 33:957–967 [PMC free article] [PubMed]
Jackson CE, Weiss L, Watson JH (1974) “Brittle” hair with short stature, intellectual impairment and decreased fertility: an autosomal recessive syndrome in an Amish kindred. Pediatrics 54:201–207 [PubMed]
Jorizzo JL, Atherton DJ, Crounse RG, Wells RS (1982) Ichthyosis, brittle hair, impaired intelligence, decreased fertility and short stature (IBIDS syndrome). Br J Dermatol 106:705–710 [PubMed]
Nakabayashi K, Fernandez BA, Teshima I, Shuman C, Proud VK, Curry CJ, Chitayat D, Grebe T, Ming J, Oshimura M, Meguro M, Mitsuya K, Deb-Rinker P, Herbrick JA, Weksberg R, Scherer SW (2002) Molecular genetic studies of human chromosome 7 in Russell-Silver syndrome. Genomics 79:186–196 [PubMed] [Cross Ref]10.1006/geno.2002.6695
Pollitt RJ, Jenner FA, Davies M (1968) Sibs with mental and physical retardation and trichorrhexis nodosa with abnormal amino acid composition of the hair. Arch Dis Child 43:211–216 [PMC free article] [PubMed]
Price VH, Odom RB, Ward WH, Jones FT (1980) Trichothiodystrophy: sulfur-deficient brittle hair as a marker for a neuroectodermal symptom complex. Arch Dermatol 116:1375–1384 [PubMed] [Cross Ref]10.1001/archderm.116.12.1375
Przedborski S, Ferster A, Goldman S, Wolter R, Song M, Tonnesen T, Pollitt RJ, Vamos E (1990) Trichothiodystrophy, mental retardation, short stature, ataxia, and gonadal dysfunction in three Moroccan siblings. Am J Med Genet 35:566–573 [PubMed]
Rizzo R, Pavone L, Micali G, Calvieri S, Di Gregorio L (1992) Trichothiodystrophy: report of a new case with severe nervous system impairment. J Child Neurol 7:300–303 [PubMed]
Saarialho-Kere UK, Chang ES, Welgus HG, Parks WC (1992) Distinct localization of collagenase and tissue inhibitor of metalloproteinases expression in wound healing associated with ulcerative pyogenic granuloma. J Clin Invest 90:1952–1957 [PMC free article] [PubMed]
Scherer SW, Cheung J, MacDonald JR, Osborne LR, Nakabayashi K, Herbrick JA, Carson AR, et al (2003) Human chromosome 7: DNA sequence and biology. Science 300:767–772 [PMC free article] [PubMed] [Cross Ref]10.1126/science.1083423
Seboun E, Lemainque A, Jackson CE. Amish brittle hair syndrome gene maps to 7p14.1. Am J Med Genet (in press) [PubMed]
Stefanini M, Giliani S, Nardo T, Marinoni S, Nazzaro V, Rizzo R, Trevisan G (1992) DNA repair investigations in nine Italian patients affected by trichothiodystrophy. Mutat Res 273:119–125 [PubMed]
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25:4876–4882 [PMC free article] [PubMed] [Cross Ref]10.1093/nar/25.24.4876
Weeda G, Eveno E, Donker I, Vermeulen W, Chevallier-Lagente O, Taieb A, Stary A, Hoeijmakers JH, Mezzina M, Sarasin A (1997) A mutation in the XPB/ERCC3 DNA repair transcription gene, associated with trichothiodystrophy. Am J Hum Genet 60:320–329 [PMC free article] [PubMed]

Articles from American Journal of Human Genetics are provided here courtesy of American Society of Human Genetics
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...