Dicer-1 has been shown to be the pre-miRNA processing factor in Drosophila [58]. We have previously shown that depletion of Dicer-1 by RNAi resulted in a marked accumulation of pre-miR-bantam (pre-miR-ban) [60]. Depletion of Loqs by RNAi resulted in a similar effect to Dicer-1 depletion for miR-ban (Figure 2A). Loqs dsRNAs caused the suppression of Loqs mRNA (Figure 2B). RNAi against Loqs does not appear to affect Dicer-1 protein levels (lower panel in Figure 2B), suggesting that the observed pre-miRNA accumulation in Loqs-depleted cells is not simply due to destabilizing Dicer-1. Similar effects on miR-8 were seen in Dicer-1- and Loqs-depleted S2 cells (Figure 2C). Depletion of Dicer-2 and R2D2, which form the enzyme complex predominantly responsible for generating siRNAs from long dsRNA [59], had no significant effect on pre-miRNA processing (Figure 2A and and2C).2C). These results show that along with Dicer-1, Loqs is essential for efficient pre-miRNA processing in vivo.

To further examine the requirement for Loqs in pre-miRNA processing, we purified Flag–Dicer-1 complex under a harsher condition (high salt), where Dicer-1 was stripped of most Loqs protein (Figure 6A), and used this Dicer-1 complex in pre-miRNA processing assays with or without supplement of recombinant GST–Loqs (see left panel in Figure 3C). Without any supplement, the Flag–Dicer-1 complex purified under the harsh condition showed less activity than that under mild condition (Figure 6B). Then we added GST–Loqs in the assay mixture. The addition of GST–Loqs to the Dicer-1 complex stimulated the processing of pre-miRNA (Figure 6C). GST–Loqs alone did not show any significant pre-miRNA processing activity (Figure 6C). These results show that Loqs is required for stimulating the processing of pre-miRNAs. Interestingly, we found that the Dicer-1 complex purified under the harsh condition displayed considerable siRNA-generating activity on the long dsRNA substrate in vitro (Figure 6D), although previous genetic studies have shown that Dicer-1 is not required for siRNA production [58]. The addition of GST–Loqs inhibited this effect (Figure 6D). Western blot analysis failed to show that the Dicer-1 complex used in this experiment contains Dicer-2 (right panel inFigure 6D). GST–Loqs alone showed no activity for generating siRNAs from long dsRNAs. These results suggested that Dicer-1 stripped of much of its bound Loqs processes both dsRNA and pre-miRNA substrates, but re-addition of recombinant Loqs suppresses dsRNA processing activity and enhances pre-miRNA processing activity. Our findings thus imply that much of the apparent substrate specificity of Dicer-1 in vivo results from its association with Loqs. Although very unlikely (Figure 6D), it is, however, formally possible that the Dicer-1 immunoprecipitates may contain very small amounts of Dicer-2 protein that can catalyze long dsRNA cleavage, and that addition of a large amount of dsRBD-containing Loqs may block the activity of Dicer-2 in this experiment.

We examined the presence of endogenous miRNA in RNA preparations from Flag–Dicer-1 and Flag–Loqs complexes obtained from S2 cells using anti-Flag antibodies. Complexes were prepared as in Figure 3A, and RNA preparations from each complex were subjected to Northern blotting using an oligo probe recognizing both pre-miR-ban and mature miR-ban. The Dicer-1 complex contained both the pre- and mature form of miR-ban, and the complex seems to preferentially bind the precursor form of miR-ban (Figure 7A). In contrast, the precursor form of miR-ban was barely detectable in the Loqs complex, though it contained mature miR-ban. However, EDTA treatment, which inhibits pre-miRNA processing activity (see Figure 5D), resulted in an accumulation of pre-miR-ban in the Loqs complex (Figure 7A). This may suggest that part of Flag-tagged Loqs protein interacts with Dicer-1 or pre-miRNAs or both. Alternatively, Flag–Loqs complexes may rapidly process pre-miRNAs into mature miRNAs and, therefore, may only transiently interact with them. Nonetheless, these results suggest that Dicer-1–Loqs complexes associate with both pre- and mature miRNAs in vivo.

Total RNA was isolated from S2 cells with ISOGEN (Nippon Gene, Toyama, Japan). 20 μg of total RNA was separated on 12% acrylamide-denaturing gel and transferred onto Hybond-N+ membrane (Amersham Bioscience, Little Chalfont, United Kingdom). After UV-crosslinking, the hybridization was performed at 42 °C in 0.2 M sodium phosphate (pH 7.2), 7 % SDS, and 1 mM EDTA with end-labeled antisense oligodeoxynucleotide, and washed at 42 °C in 2× saline sodium citrate and 0.1% SDS. Oligodeoxynucleotides used as probes were: bantam, 5′- CAGCTTTCAAAATGATCTCAC-3′; miR-8, 5′- GACATCTTTACCTGACAGTATTA-3′; U6 snRNA, 5′- GGGCCATGCTAATCTTCTCTGTA-3′; and let-7, 5′- AACTATACAACCTACTACCTCA-3.′ The blots were exposed on BAS-MS2040 imaging plates, and signals were quantified using BAS-2500 (Fuji, Tokyo, Japan).

One μg of total RNA was used for the first-strand cDNA synthesis with Stratascript RT and random primers (Stratagene, La Jolla, California, United States). Sequences of the oligonucleotide primers for RT-PCR were: Dicer-1, 5′- ACCAATGTACTGCGTTTGCA and 5′- GTTTGCTGATCACAGAACTTAACGTT; Loqs, 5′- ATGGACCAGGAGAATTTCCACGG-3′ and 5′- CTACTTCTTGGTCATGATCTTCAAGTAC-3′; and AGO2, 5′- GCACAAGTGTGCGGTCTTGTATT-3′ and 5′- GTGAACTGCTTAATGCATTG-3′.

Immunofluorescence analysis was performed by fixing S2 cells with 2% formaldehyde for 15 min. Cells were permeabilized using 0.1% Triton X-100. Flag-tagged proteins were stained for 30 min with anti-Flag M2 (1:1,000 dilution) antibody (Sigma, St. Louis, Missouri, United States). After extensive wash in PBS, cells were treated with 100 μg/ml RNaseA for 30 min and then stained with 0.4 μg/ml propidium iodide. Alexa-488 anti-mouse IgG was used as secondary antibody. All images were collected using a Zeiss (Oberkochen, Germany) LSM510 laser scanning microscope.

S2 cell lines, stably expressed 3× Flag-tagged Dicer-1 or Loqs, or myc-tagged-Loqs under the control of metallothionein promoter (originally from pRmHa-3 vector), were established. The expression of each protein was induced by adding copper ions into the medium. After overnight incubation, the whole cell extract was prepared in Buffer A (30 mM HEPES pH 7.4, 150 mM KOAc, 2 mM MgOAc, 5 mM DTT, 2 μg/ml Leupeptin, 2 μg/ml Pepstatin, 0.5% Aprotinin) containing 0.1% NP-40 by sonication, and followed by centrifugation. Flag–Dicer-1 and Flag–Loqs were bound to anti-Flag M2 agarose beads at 4 °C for 1 h. Immunoprecipitated proteins were then recovered with 2× SDS sample buffer or Elution buffer (Buffer A containing 400 μg/ml of 3× Flag peptides, 10% glycerol, and 100 mM KOAc). For Northern blot analysis of RNAs co-purified with Flag–Dicer-1 or Flag–Loqs, immunoprecipitates on beads were treated with ISOGEN and subjected to RNA purification.

To produce [³⁵S]methionine-labeled proteins by a TNT in vitro transcription and translation kit (Promega, Madison, Wisconsin, United States), the Dicer-1 cDNA was inserted into an expression vector, pET-28 (Novagen, Madison, Wisconsin, United States). GST pull-down assays were carried out using GST–Loqs and GST itself that were bound to glutathione Sepharose 4B resins (Amersham Biosciences) in Buffer A containing 0.1% NP-40. After incubation with TNT products and extensive washing, the bound proteins were separated by SDS-PAGE. RNaseA treatment was carried out by adding the enzyme to the binding mixture. To produce GST fusion protein, Loqs cDNA was subcloned into a pGEX-5X expression vector (Amersham Biosciences). The fusion proteins, as well as GST itself, were induced and purified as described by the manufacturer.

S2 cells were suspended at approximately 1 × 10⁸ cells/ml into Hypotonic buffer (Buffer A without KOAc) and lysed by passing through a 30G needle. After centrifugation at 500 × g for 20 min, the supernatant and the precipitate were separated. The supernatant was centrifuged to obtain the supernatant as a cytoplasmic lysate. The pellet was washed twice with Hypotonic buffer and lysed by sonication in Buffer A containing 100 mM KOAc and 20% glycerol, followed by centrifugation to obtain the supernatant as a nuclear lysate. Total protein concentration in each lysate was determined with Protein assay (Bio-Rad, Hercules, California, United States) and adjusted to be equal.

A DNA fragment coding pri-miR-ban was obtained from PCR reaction (primers used are: 5′- CGCTCAGATGCAGATGTTGTTGAT-3′ and 5′- GATCGGTCGGCATAAG TTCAAAGC-3′) and cloned into the SmaI site of pBluescriptSK vector in the same direction with the T3 promoter. The plasmid was digested with ClaI, gel-isolated, and used as a template for in vitro transcription reaction with MEGAscript T3 Kit (Ambion, Austin, Texas, United States) in the presence of [α³²P]GTP. In vitro processing reaction of pri-miRNAs was performed with some modifications to previously reported method [36]. Briefly, in 1 ml reaction, 10 mM creatine phosphate, 0.5 mM ATP, 30 μg/ml creatine kinase, 0.1 U/ul RNasin, 0.1 μg yeast RNA, and 500 μl nuclear lysate were added, and pri-miR-bantam in 0.5× Buffer A with 100 mM KOAc was further added to the mixture. After 2 h incubation at 26 °C, RNAs were purified with ISOGEN LS (Nippon Gene) and separated on 7.5% acrylamide denaturing gel, from which pre-miR-ban (about 60 nucleotides in length) was recovered.

The condition used for in vitro pre-miRNA processing with cytoplasmic lysates was the same as that for the in vitro pri-miR-bantam processing. Cytoplasmic lysate used in this assay was 5 μl in a 10-μl reaction. For processing assays with purified complexes, immuno-purified Flag–Dicer-1 or Flag–Loqs was used instead of crude cytoplasmic lysate and the final concentration of buffer adjusted. For Mg⁺⁺-depletion assay, 10 mM EDTA was added instead of Mg⁺⁺. For the processing by Flag–Dicer-1, high-salt purified (800 mM KOAc) Flag–Dicer-1 was added in the presence or absence of bacterially produced GST–Loqs and the final concentration of buffer adjusted.

Preparation of cap-labeled ftz RNA with a let-7 target site and RNAi reaction were carried out essentially as described [60]. In brief, 10⁴ cpm of cap-labeled let-7 target RNA was incubated with 200 nM in vitro transcribed pre-let-7 RNA in Buffer A containing 100 mM KOAc, 10 mM creatine phosphate, 0.5 mM ATP, 30 μg/ml creatine kinase, and 0.1 U/ul RNasin. Reactions were allowed to proceed for 3 h at 26 °C. Cleavage products of the RNAi reaction were analyzed by electrophoresis on 4% denaturing polyacrylamide gels.