• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of plosbiolPLoS BiologySubmit to PLoSGet E-mail AlertsContact UsPublic Library of Science (PLoS)View this Article
PLoS Biol. Jul 2005; 3(7): e235.
Published online May 24, 2005. doi:  10.1371/journal.pbio.0030235
PMCID: PMC1141268

Processing of Pre-microRNAs by the Dicer-1–Loquacious Complex in Drosophila Cells

James C. Carrington, Academic Editor


microRNAs (miRNAs) are a large family of 21- to 22-nucleotide non-coding RNAs that interact with target mRNAs at specific sites to induce cleavage of the message or inhibit translation. miRNAs are excised in a stepwise process from primary miRNA (pri-miRNA) transcripts. The Drosha-Pasha/DGCR8 complex in the nucleus cleaves pri-miRNAs to release hairpin-shaped precursor miRNAs (pre-miRNAs). These pre-miRNAs are then exported to the cytoplasm and further processed by Dicer to mature miRNAs. Here we show that Drosophila Dicer-1 interacts with Loquacious, a double-stranded RNA-binding domain protein. Depletion of Loquacious results in pre-miRNA accumulation in Drosophila S2 cells, as is the case for depletion of Dicer-1. Immuno-affinity purification experiments revealed that along with Dicer-1, Loquacious resides in a functional pre-miRNA processing complex, and stimulates and directs the specific pre-miRNA processing activity. These results support a model in which Loquacious mediates miRNA biogenesis and, thereby, the expression of genes regulated by miRNAs.


microRNAs (miRNAs) act as RNA guides by binding to complementary sites on target mRNAs to regulate gene expression at the post-transcriptional level in plants and animals [1−12], much as small interfering RNAs (siRNAs) do in the RNA interference (RNAi) pathway [13−15]. The expression of miRNAs is often developmentally regulated in a tissue-specific manner, suggesting an important role for miRNAs in the regulation of endogenous gene expression [16–30]. The importance of miRNAs for development is also highlighted by a recent computer-based analysis that predicted nearly a thousand miRNA genes in the human genome [31]. Furthermore, recent studies have revealed that miRNAs regulate a large fraction of the protein-coding genes [32–34].

miRNAs are transcribed as long primary miRNA (pri-miRNA) transcripts by RNA polymerase II [35]. miRNA maturation begins with cleavage of the pri-miRNAs by the nuclear RNase III Drosha [36–38] to release approximately 70-nucleotide hairpin-shaped structures, called precursor miRNAs (pre-miRNAs). Pre-miRNAs are then exported to the cytoplasm by the protein Exportin 5, which recognizes the two-nucleotide 3′ overhang that is a signature of RNase III-mediated cleavage [39–41]. In the cytoplasm, pre-miRNAs are subsequently cleaved by a second RNase III enzyme, Dicer, into approximately 22-nucleotide miRNA duplexes, with an end structure characteristic of RNase III cleavage [42–44]. Only one of the two strands is predominantly transferred to the RNA-induced silencing complex (RISC) [45], which mediates either cleavage of the target mRNA or translation silencing, depending on the complementarity of the target [46] by a mechanism that remains unclear [47].

There is a growing list of double-stranded RNA (dsRNA)-binding proteins that play important yet distinct roles in the RNAi pathway [48]. Both Drosha and Dicer contain dsRNA-binding domains (dsRBDs). Drosha requires a dsRNA-binding protein partner known as Pasha in flies and Caenorhabditis elegans, and its ortholog DGCR8 in mammals to convert pri-miRNAs to pre-miRNAs [49–52]. In plants, the predominantly nuclear Dicer-like-1, equipped with two dsRBDs, is thought to catalyze both pri-miRNA and pre-miRNA processing [53,54]. The HYL1 protein, which also contains a tandem dsRBD, is required for miRNA accumulation and may play the same molecular role as Pasha/DGCR8 for Dicer-like-1 in plants [55,56]. In Drosophila, Dicer-2 is required for production of siRNAs [57,58], and forms a heterodimeric complex with the dsRNA-binding protein R2D2, which is required for its function in RISC assembly, although Dicer-2 alone suffices to convert long dsRNA into siRNAs [59]. Drosophila Dicer-1 is associated with the processing of pre-miRNAs [58,60]. However, if there is a dsRNA-binding protein partner for Dicer-1, it has not been identified.

Here, we show that Drosophila Dicer-1 interacts with the dsRBD protein Loquacious (Loqs). Depletion of Loqs results in accumulation of pre-miRNAs in Drosophila S2 cells. Loqs is predominantly cytoplasmic and is conserved in mammals. Immuno-affinity purification experiments, together with the use of recombinant Loqs, reveal that along with Dicer-1, Loqs resides in a functional pre-miRNA processing complex, and stimulates and directs specific pre-miRNA processing activity. These results support a model in which Loqs mediates miRNA biogenesis and, thereby, the expression of genes regulated by miRNAs.


We have used RNAi-based reverse-genetic methods [61] to screen a list of Drosophila dsRBD proteins [62] for a protein(s) that has an effect on miRNA biogenesis in Drosophila S2 cells and found a novel protein equipped with three dsRBDs (two canonical dsRBDs at the N-terminal half, and one non-canonical dsRBD at the C-terminal), originally dubbed CG6866 (candidate gene 6866), which has a role in pre-miRNA processing (data presented below). This protein bears high similarity to R2D2 and to the C. elegans RNAi protein RDE-4 (Figure 1), both of which contain dsRBDs and interact with Dicer [59,63]. Thus the sequence data show that CG6866 is a paralog of R2D2. A parallel study presents genetic evidence that several types of silencing are lost in CG6866 mutant flies (Förstemann K, et al. DOI: 10.1371/journal.pbio.0030236). Therefore, CG6866 was designated as Loquacious (“very talkative”).

Figure 1
Loqs/CG6866 Is a Paralog of R2D2

Depletion of Loqs and Dicer-1 by RNAi Resultsin Pre-miRNA Accumulation

Dicer-1 has been shown to be the pre-miRNA processing factor in Drosophila [58]. We have previously shown that depletion of Dicer-1 by RNAi resulted in a marked accumulation of pre-miR-bantam (pre-miR-ban) [60]. Depletion of Loqs by RNAi resulted in a similar effect to Dicer-1 depletion for miR-ban (Figure 2A). Loqs dsRNAs caused the suppression of Loqs mRNA (Figure 2B). RNAi against Loqs does not appear to affect Dicer-1 protein levels (lower panel in Figure 2B), suggesting that the observed pre-miRNA accumulation in Loqs-depleted cells is not simply due to destabilizing Dicer-1. Similar effects on miR-8 were seen in Dicer-1- and Loqs-depleted S2 cells (Figure 2C). Depletion of Dicer-2 and R2D2, which form the enzyme complex predominantly responsible for generating siRNAs from long dsRNA [59], had no significant effect on pre-miRNA processing (Figure 2A and and2C).2C). These results show that along with Dicer-1, Loqs is essential for efficient pre-miRNA processing in vivo.

Figure 2
Depletion of Loqs and Dicer-1 Causes Pre-miRNA Accumulation

Loqs Associates with Dicer-1 In Vivo and In Vitro

This observation prompted us to ask if Loqs forms a complex in vivo with Dicer-1. For these studies, we simultaneously expressed Dicer-1 tagged with the Flag epitope and Loqs tagged with the myc epitope in S2 cells. We then immunoprecipitated Dicer-1 with anti-Flag antibodies, and Loqs with anti-myc antibody and then analyzed the precipitates by immunoblotting (Figure 3A). In reciprocal assays, Dicer-1 and Loqs were found to co-precipitate. Consistent with these findings that Dicer-1 and Loqs form a complex in vivo, both proteins are localized predominantly in the cytoplasm of S2 cells (Figure 3B).

Figure 3
Loqs Associates with Dicer-1

We further investigated whether Loqs can bind to Dicer-1 in vitro. Dicer-1 was produced by an in vitro translation system and used in binding assays with recombinant Loqs fused to glutathione S-transferase (GST). GST–Loqs interacted with Dicer-1 even in the presence of RNase A, whereas GST itself showed no detectable binding (Figure 3C). These results demonstrate that the association of Loqs with Dicer-1 occurs both in vivo and in vitro, and that RNA molecules do not appear to mediate the association.

Dicer-1 and Loqs Are Present in a Functional Complex That Mediates Pre-miRNA Processing

To examine the functional connection between the Dicer-1–Loqs complex and pre-miRNA processing, we investigated if depletion of Dicer-1 or Loqs had any effect on the production of mature miRNA from the precursor. We first tested if cytoplasmic lysates of S2 cells were capable of processing synthetic Drosophila melanogasterlet-7 precursor RNA into functional mature let-7. In this experiment, the synthetic let-7 precursor RNA was converted to mature let-7 in S2 cytoplasmic lysates (Figure 4A), as is the case in embryo lysates [60]. In in vitro RNAi assay, target RNA harboring a sequence perfectly complementary to mature let-7 was cleaved efficiently within the let-7 complementary sequence (Figure 4B), thus showing production of functional let-7 in S2 cell lysates. Cytoplasmic lysates from Dicer-1- or Loqs-depleted cells were then subjected to the pre-let-7 processing assay. Both Dicer-1 and Loqs depletion led to reductions of mature let-7 compared with controls (Figure 4C), showing that both Dicer-1 and Loqs function in pre-miRNA processing.

Figure 4
Synthetic D. melanogasterlet-7 Precursor Processing in the Cytoplasmic Lysate of S2 Cells

We next used pre-miR-ban as a substrate for pre-miRNA processing assays. It was shown recently that S2 cell extracts contained pri-miRNA processing activity that cleaved pri-miRNA into an approximately 60- to 70-bp pre-miRNA precursor [49]. This processing is known to occur in the nucleus; thus pre-miR-ban was prepared by in vitro processing of pri-miR-ban incubated with S2 nuclear extracts (Figure 5A). Uniformly labeled pre-miR-ban was then gel-purified and used as a substrate for analysis of pre-miRNA processing. Incubation of the pre-miRNA with S2 cytoplasmic extracts resulted in the appearance of a mature 21-nucleotide miR-ban (Figure 5B). We then examined the requirement of Dicer-1 and Loqs in pre-miR-ban processing. Incubation of pre-miRNA with Dicer-1- and Loqs-depleted S2 cytoplasmic extracts resulted in a marked reduction in mature miRNA levels (Figure 5B). In contrast, depletion of Dicer-2 or R2D2 showed no measurable reduction of mature miRNA levels (Figure 5B). We then assayed the pre-miRNA processing activity of the purified complexes (both Flag–Dicer-1 and Flag–Loqs complexes). That the Flag–Loqs complex contains Dicer-1 was confirmed by immunoblotting (data not shown). Both Dicer-1 and Loqs complexes were capable of generating maturemiR-ban from pre-miR-ban (Figure 5C). Several steps in the RNAi and miRNA pathways are known to require a divalent metal ion [64]. In addition, it is well known that RNase III-type enzymes require divalent metals for cleavage [65]. Flag–Dicer-1 complex was employed and the processing was performed in the presence of magnesium ions or EDTA in a buffer. As shown in Figure 5D, no pre-miRNA processing activity was detected at 10 mM EDTA. These results demonstrated that the Dicer-1–Loqs complex converts pre-miRNAs into mature miRNAs in a divalent metal ion–dependent manner.

Figure 5
In Vitro Processing Activities of Loqs and Dicer-1

Loqs Stimulates and Confers upon Dicer-1 the Specific Processing of Pre-miRNAs

To further examine the requirement for Loqs in pre-miRNA processing, we purified Flag–Dicer-1 complex under a harsher condition (high salt), where Dicer-1 was stripped of most Loqs protein (Figure 6A), and used this Dicer-1 complex in pre-miRNA processing assays with or without supplement of recombinant GST–Loqs (see left panel in Figure 3C). Without any supplement, the Flag–Dicer-1 complex purified under the harsh condition showed less activity than that under mild condition (Figure 6B). Then we added GST–Loqs in the assay mixture. The addition of GST–Loqs to the Dicer-1 complex stimulated the processing of pre-miRNA (Figure 6C). GST–Loqs alone did not show any significant pre-miRNA processing activity (Figure 6C). These results show that Loqs is required for stimulating the processing of pre-miRNAs. Interestingly, we found that the Dicer-1 complex purified under the harsh condition displayed considerable siRNA-generating activity on the long dsRNA substrate in vitro (Figure 6D), although previous genetic studies have shown that Dicer-1 is not required for siRNA production [58]. The addition of GST–Loqs inhibited this effect (Figure 6D). Western blot analysis failed to show that the Dicer-1 complex used in this experiment contains Dicer-2 (right panel inFigure 6D). GST–Loqs alone showed no activity for generating siRNAs from long dsRNAs. These results suggested that Dicer-1 stripped of much of its bound Loqs processes both dsRNA and pre-miRNA substrates, but re-addition of recombinant Loqs suppresses dsRNA processing activity and enhances pre-miRNA processing activity. Our findings thus imply that much of the apparent substrate specificity of Dicer-1 in vivo results from its association with Loqs. Although very unlikely (Figure 6D), it is, however, formally possible that the Dicer-1 immunoprecipitates may contain very small amounts of Dicer-2 protein that can catalyze long dsRNA cleavage, and that addition of a large amount of dsRBD-containing Loqs may block the activity of Dicer-2 in this experiment.

Figure 6
Loqs Stimulates the Specific Processing of Pre-miRNA by Dicer-1

Dicer-1–Loqs Complexes Associate with Pre- and Mature miRNAs In Vivo

We examined the presence of endogenous miRNA in RNA preparations from Flag–Dicer-1 and Flag–Loqs complexes obtained from S2 cells using anti-Flag antibodies. Complexes were prepared as in Figure 3A, and RNA preparations from each complex were subjected to Northern blotting using an oligo probe recognizing both pre-miR-ban and mature miR-ban. The Dicer-1 complex contained both the pre- and mature form of miR-ban, and the complex seems to preferentially bind the precursor form of miR-ban (Figure 7A). In contrast, the precursor form of miR-ban was barely detectable in the Loqs complex, though it contained mature miR-ban. However, EDTA treatment, which inhibits pre-miRNA processing activity (see Figure 5D), resulted in an accumulation of pre-miR-ban in the Loqs complex (Figure 7A). This may suggest that part of Flag-tagged Loqs protein interacts with Dicer-1 or pre-miRNAs or both. Alternatively, Flag–Loqs complexes may rapidly process pre-miRNAs into mature miRNAs and, therefore, may only transiently interact with them. Nonetheless, these results suggest that Dicer-1–Loqs complexes associate with both pre- and mature miRNAs in vivo.

Figure 7
Dicer-1–Loqs Complexes Are Associated with Pre-miRNA and Mature miRNA In Vivo

An AGO1-Associated Complex Contains Dicer-1 and Loqs, and Is Capable of Pre-miRNA Processing

We have previously shown that Argonaute protein AGO1 is required for stable production of mature miRNAs and associates with Dicer-1 [60]. Thus, we sought to ascertain if Loqs was also present in an AGO1-associated complex, and if so, if the AGO1 complex was capable of processing pre-miRNA in vitro. We simultaneously expressed Flag–Loqs and AGO1 tagged with TAP in S2 cells and purified the AGO1–TAP complex through immunoglobulin G (IgG) bead-binding. The IgG bound was then subjected to Western blot analysis using anti-Dicer-1, anti-AGO1, or anti-Flag (for Loqs detection) antibodies. Not only Dicer-1 but also Loqs was detected in the AGO1 complex (Figure 7B). These results indicated that all three proteins are present in the same complex, although they cannot exclude the possibility that there is one complex that contains AGO1 and Dicer-1 but not Loqs, and another complex that contains AGO1 and Loqs but not Dicer-1. The pre-miRNA processing activity of the AGO1 complex was then examined. As in Figure 5, pre-miR-ban was utilized as a substrate. The AGO1 complex was able to efficiently process pre-miR-ban into the mature form (Figure 7C). In contrast, another Argonaute protein AGO2-associated complex showed no such activity, which is consistent with our previous finding that the AGO2-associated complex does not contain Dicer-1 [60]. Considered together, these results showed that Dicer-1 and Loqs form a functional complex that mediates the genesis of mature miRNAs from pre-miRNAs, and suggested that the resultant mature miRNAs are loaded onto an AGO1-associated complex, which probably is miRNA-associated RISC [60], through specific interaction of AGO1 with Dicer-1 and Loqs.


Our results indicate that Loqs and Dicer-1 form a complex that converts pre-miRNAs into mature miRNAs; so how do they act together in pre-miRNA processing? Sequence comparison reveals that Loqs is a paralog of R2D2 (see Figure 1). Therefore, Loqs may play the molecular role of R2D2 for Dicer-1. R2D2 forms a stable heterodimeric complex with Dicer-2, while either protein alone seems to be unstable in vivo [59]. In the absence of R2D2, Dicer-2 is still capable of efficiently processing long dsRNA into siRNAs. Therefore, the siRNA generating activity of Dicer-2 is not dependent upon R2D2. However, the resultant siRNAs are not effectively channeled into RISC in the absence of R2D2. The Dicer-2–R2D2 complex, but not Dicer-2 alone, binds to siRNA, which indicates that siRNA binding by the heterodimer is important for RISC entry [59,66]. In the case of Loqs, this protein alone is not capable of converting pre-miRNAs into mature miRNAs, but it clearly stimulates and directs the specific pre-miRNA processing activity of Dicer-1. Furthermore, knocking down Loqs markedly reduced the pre-miRNA processing activity in cytoplasmic lysates in vitro (see Figures 4C and and5B),5B), but did not cause a significant reduction of the level of Dicer-1 protein (see Figure 2B); implying that Dicer-1 may largely depend on Loqs for its pre-miRNA processing activity. Thus, the molecular role of Loqs for Dicer-1 is not simply similar to that of R2D2 for Dicer-2.

It can be envisioned that Loqs may have one of several roles in pre-miRNA processing. Dicer-1 contains only one dsRBD, which may not be sufficient for strong interaction with and/or specific recognition of the pre-miRNA substrate (see Figure 6C and and6D).6D). Loqs, containing three dsRBDs with no other identifiable domains being apparent, could provide the additional RNA-binding modules required for specific recognition of the pre-miRNA, and thereby stabilize pre-miRNA binding for Dicer-1. Loqs could also organize binding of Dicer-1 on the pre-miRNA, contributing to the specific positioning of the Dicer-1 cleavage site. Alternatively, since dsRBDs are known to not only bind dsRNAs but also mediate protein–protein interactions [67], Loqs may directly bind Dicer-1 through its dsRBDs. This protein–protein interaction may trigger a conformational change of Dicer-1 that facilitates either the formation of an intramolecular dimer of its two RNase III domains [50,68], which creates a pair of catalytic sites, or the handover of the Dicer-1 cleaved mature miRNAs to the RISC.

Sequence analysis revealed that protein activator of protein kinase dsRNA dependent (PKR) (PACT) [69] and HIV TAR RNA binding protein (TRBP) [70] in mammals bear 34% identity to Loqs, and share a highly similar domain structure with it (Figure 8). Both PACT and TRBP are thought to play a role in the regulation of translation through modulating PKR that also contains two dsRBDs [71–73]. PACT interacts with PKR and enhances the autophosphorylation of PKR [67], which in turn, phosphorylates the α subunit of eukaryotic translation initiation factor 2 (eIF2α) and leads to an inhibition of mRNA translation in response to viral infection and other stimuli. TRBP prevents PKR-mediated inhibition of protein synthesis through binding to PKR [74]. Considered together, it will be important to find out Loqs' partners other than Dicer-1 for possible involvement of Loqs in miRNA-mediated translational regulation in Drosophila.

Figure 8
Domain Structure of Loqs and ItsHomo sapiens and Xenopus Homologs

Materials and Methods


dsRNAs were introduced to S2 cells by soaking essentially as described [75]. Briefly, approximately 5 × 106 cells were soaked in 1 ml of serum-free medium containing 15 μg of dsRNA for 30 min at room temperature followed by addition of 2 ml of the medium containing 15% serum, 3 mM glutamine, and penicillin-streptomycin. After 4 d, cells were harvested and subjected to total RNA preparation for Northern blot analysis, or cytoplasmic lysate preparation for in vitro processing assays. dsRNAs used in RNAi were: double-stranded RNA for enhanced green fluorescent protein (EGFP), homologous to nucleotides 11–717 of the EGFP coding sequence; dsDcr-2, 4091–4888 of the Dicer-2 coding; dsR2D2, 1–936; dsDcr-1, 10–950 of the Dicer-2 coding; dsLoqs, 330-1342.

Northern blot analysis

Total RNA was isolated from S2 cells with ISOGEN (Nippon Gene, Toyama, Japan). 20 μg of total RNA was separated on 12% acrylamide-denaturing gel and transferred onto Hybond-N+ membrane (Amersham Bioscience, Little Chalfont, United Kingdom). After UV-crosslinking, the hybridization was performed at 42 °C in 0.2 M sodium phosphate (pH 7.2), 7 % SDS, and 1 mM EDTA with end-labeled antisense oligodeoxynucleotide, and washed at 42 °C in 2× saline sodium citrate and 0.1% SDS. Oligodeoxynucleotides used as probes were: bantam, 5′- CAGCTTTCAAAATGATCTCAC-3′; miR-8, 5′- GACATCTTTACCTGACAGTATTA-3′; U6 snRNA, 5′- GGGCCATGCTAATCTTCTCTGTA-3′; and let-7, 5′- AACTATACAACCTACTACCTCA-3.′ The blots were exposed on BAS-MS2040 imaging plates, and signals were quantified using BAS-2500 (Fuji, Tokyo, Japan).

RT-PCR analysis

One μg of total RNA was used for the first-strand cDNA synthesis with Stratascript RT and random primers (Stratagene, La Jolla, California, United States). Sequences of the oligonucleotide primers for RT-PCR were: Dicer-1, 5′- ACCAATGTACTGCGTTTGCA and 5′- GTTTGCTGATCACAGAACTTAACGTT; Loqs, 5′- ATGGACCAGGAGAATTTCCACGG-3′ and 5′- CTACTTCTTGGTCATGATCTTCAAGTAC-3′; and AGO2, 5′- GCACAAGTGTGCGGTCTTGTATT-3′ and 5′- GTGAACTGCTTAATGCATTG-3′.

Immunofluorescence analysis

Immunofluorescence analysis was performed by fixing S2 cells with 2% formaldehyde for 15 min. Cells were permeabilized using 0.1% Triton X-100. Flag-tagged proteins were stained for 30 min with anti-Flag M2 (1:1,000 dilution) antibody (Sigma, St. Louis, Missouri, United States). After extensive wash in PBS, cells were treated with 100 μg/ml RNaseA for 30 min and then stained with 0.4 μg/ml propidium iodide. Alexa-488 anti-mouse IgG was used as secondary antibody. All images were collected using a Zeiss (Oberkochen, Germany) LSM510 laser scanning microscope.

Immunoprecipitation of Flag–Dicer-1, Flag–Loqs, and myc-Loqs

S2 cell lines, stably expressed 3× Flag-tagged Dicer-1 or Loqs, or myc-tagged-Loqs under the control of metallothionein promoter (originally from pRmHa-3 vector), were established. The expression of each protein was induced by adding copper ions into the medium. After overnight incubation, the whole cell extract was prepared in Buffer A (30 mM HEPES pH 7.4, 150 mM KOAc, 2 mM MgOAc, 5 mM DTT, 2 μg/ml Leupeptin, 2 μg/ml Pepstatin, 0.5% Aprotinin) containing 0.1% NP-40 by sonication, and followed by centrifugation. Flag–Dicer-1 and Flag–Loqs were bound to anti-Flag M2 agarose beads at 4 °C for 1 h. Immunoprecipitated proteins were then recovered with 2× SDS sample buffer or Elution buffer (Buffer A containing 400 μg/ml of 3× Flag peptides, 10% glycerol, and 100 mM KOAc). For Northern blot analysis of RNAs co-purified with Flag–Dicer-1 or Flag–Loqs, immunoprecipitates on beads were treated with ISOGEN and subjected to RNA purification.

Protein–protein interaction assays

To produce [35S]methionine-labeled proteins by a TNT in vitro transcription and translation kit (Promega, Madison, Wisconsin, United States), the Dicer-1 cDNA was inserted into an expression vector, pET-28 (Novagen, Madison, Wisconsin, United States). GST pull-down assays were carried out using GST–Loqs and GST itself that were bound to glutathione Sepharose 4B resins (Amersham Biosciences) in Buffer A containing 0.1% NP-40. After incubation with TNT products and extensive washing, the bound proteins were separated by SDS-PAGE. RNaseA treatment was carried out by adding the enzyme to the binding mixture. To produce GST fusion protein, Loqs cDNA was subcloned into a pGEX-5X expression vector (Amersham Biosciences). The fusion proteins, as well as GST itself, were induced and purified as described by the manufacturer.

Preparation of nuclear and cytoplasmic lysate for in vitro processing assays

S2 cells were suspended at approximately 1 × 108 cells/ml into Hypotonic buffer (Buffer A without KOAc) and lysed by passing through a 30G needle. After centrifugation at 500 × g for 20 min, the supernatant and the precipitate were separated. The supernatant was centrifuged to obtain the supernatant as a cytoplasmic lysate. The pellet was washed twice with Hypotonic buffer and lysed by sonication in Buffer A containing 100 mM KOAc and 20% glycerol, followed by centrifugation to obtain the supernatant as a nuclear lysate. Total protein concentration in each lysate was determined with Protein assay (Bio-Rad, Hercules, California, United States) and adjusted to be equal.

Preparation of pre-miR-ban

A DNA fragment coding pri-miR-ban was obtained from PCR reaction (primers used are: 5′- CGCTCAGATGCAGATGTTGTTGAT-3′ and 5′- GATCGGTCGGCATAAG TTCAAAGC-3′) and cloned into the SmaI site of pBluescriptSK vector in the same direction with the T3 promoter. The plasmid was digested with ClaI, gel-isolated, and used as a template for in vitro transcription reaction with MEGAscript T3 Kit (Ambion, Austin, Texas, United States) in the presence of [α32P]GTP. In vitro processing reaction of pri-miRNAs was performed with some modifications to previously reported method [36]. Briefly, in 1 ml reaction, 10 mM creatine phosphate, 0.5 mM ATP, 30 μg/ml creatine kinase, 0.1 U/ul RNasin, 0.1 μg yeast RNA, and 500 μl nuclear lysate were added, and pri-miR-bantam in 0.5× Buffer A with 100 mM KOAc was further added to the mixture. After 2 h incubation at 26 °C, RNAs were purified with ISOGEN LS (Nippon Gene) and separated on 7.5% acrylamide denaturing gel, from which pre-miR-ban (about 60 nucleotides in length) was recovered.

In Vitro pre-miRNA processing assays

The condition used for in vitro pre-miRNA processing with cytoplasmic lysates was the same as that for the in vitro pri-miR-bantam processing. Cytoplasmic lysate used in this assay was 5 μl in a 10-μl reaction. For processing assays with purified complexes, immuno-purified Flag–Dicer-1 or Flag–Loqs was used instead of crude cytoplasmic lysate and the final concentration of buffer adjusted. For Mg++-depletion assay, 10 mM EDTA was added instead of Mg++. For the processing by Flag–Dicer-1, high-salt purified (800 mM KOAc) Flag–Dicer-1 was added in the presence or absence of bacterially produced GST–Loqs and the final concentration of buffer adjusted.

In Vitro cleavage assay

Preparation of cap-labeled ftz RNA with a let-7 target site and RNAi reaction were carried out essentially as described [60]. In brief, 104 cpm of cap-labeled let-7 target RNA was incubated with 200 nM in vitro transcribed pre-let-7 RNA in Buffer A containing 100 mM KOAc, 10 mM creatine phosphate, 0.5 mM ATP, 30 μg/ml creatine kinase, and 0.1 U/ul RNasin. Reactions were allowed to proceed for 3 h at 26 °C. Cleavage products of the RNAi reaction were analyzed by electrophoresis on 4% denaturing polyacrylamide gels.

TAP purification

The expression of AGO1–TAP or AGO2–TAP in S2 cells was induced by adding copper ion into the medium [60]. After overnight incubation, the cytoplasmic lysate was prepared in a Buffer A containing 150 mM KOAc. AGO1–TAP or AGO2–TAP and associated materials to the TAP-tagged fusion protein were bound to IgG Sepharose (Amersham Biosciences). Bound proteins on IgG beads were directly used for in vitro pre-miRNA processing assay, or eluted with SDS sample buffer for Western blotting analysis. The polyclonal antibodies against AGO1 were a kind gift from T. Uemura (Kyoto University) [76]. The anti-Dicer-1 antibody (AB4735) was purchased from Abcam (Cambridge, United Kingdom).

Supporting Information

Accession Numbers

The GenBank (http://www.ncbi.nih.gov/Genbank/) accession numbers for the genes and gene products discussed in this paper are: ago-1 (NM_079010), ago-2 (NM_140518), dicer-1 (NM_079729), dicer-2 (NM_079054), loqs/cg6866 (NM_135802), and r2d2 (NM_135308).

The Rfam (http://www.sanger.ac.uk/Software/Rfam/mirna/index.shtml) accession numbers for the genes and gene products discussed in this paper are: bantam (MI0000387), let-7 (MI0000416), and miR-8 (MI0000128).


We thank members of the Siomi laboratory for discussions and comments on the manuscript. KS was supported in part by a fellowship from the Fragile X Research Foundation (FRAXA). AI is a predoctoral fellow (DC1) of the Japan Society for the Promotion of Science (JSPS). This work was supported by grants to MCS and HS from the Ministry of Education, Culture, Sports, Science, and Technology of Japan (MEXT) and the JSPS.

Competing interests. The authors have declared that no competing interests exist.


double-stranded RNA-binding domain
double-stranded RNA
enhanced green fluorescent protein
glutathione S-transferase
immunoglobulin G
protein activator of PKR
protein kinase dsRNA dependent
precursor miRNA
primary miRNA
RNA-induced silencing complex
RNA interference
small interfering RNA
TAR RNA binding protein.


Author contributions. KS, AI, HS, and MCS conceived and designed the experiments. KS, AI, and MCS performed the experiments. KS, AI, HS, and MCS analyzed the data. HS, KS, AI, and MCS wrote the paper.

Citation: Saito K, Ishizuka A, Siomi H, Siomi MC (2005) Processing of pre-microRNAs by the Dicer-1-loquacious complex in Drosophila cells. PLoS Biol 3(7): e235.


  • Lee RC, Feinbaum RL, Ambros V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 1993;75:843–854. [PubMed]
  • Reinhart BJ, Slack FJ, Basson M, Pasquinelli AE, Bettinger JC. The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature. 2000;403:901–906. [PubMed]
  • Llave C, Xie Z, Kasschau KD, Carrington JC. Cleavage of Scarecrow-like mRNA targets directed by a class of Arabidopsis miRNA. Science. 2002;297:2053–2056. [PubMed]
  • Brennecke J, Hipfner DR, Stark A, Russell RB, Cohen SM. bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila. Cell. 2003;113:25–36. [PubMed]
  • Palatnik JF, Allen E, Wu X, Schommer C, Schwab R. Control of leaf morphogenesis by microRNAs. Nature. 2003;425:257–263. [PubMed]
  • Xu P, Vernooy SY, Guo M, Hay BA. The Drosophila microRNA Mir-14 suppresses cell death and is required for normal fat metabolism. Curr Biol. 2003;13:790–795. [PubMed]
  • Johnston RJ, Hobert O. A microRNA controlling left/right neuronal asymmetry inCaenorhabditis elegans. Nature. 2003;426:845–849. [PubMed]
  • Chen CZ, Li L, Lodish HF, Bartel DP. MicroRNAs modulate hematopoietic lineage differentiation. Science. 2004;303:83–86. [PubMed]
  • Yekta S, Shih IH, Bartel DP. MicroRNA-directed cleavage of HOXB8 mRNA. Science. 2004;304:594–596. [PubMed]
  • Carrington JC, Ambros V. Role of microRNAs in plant and animal development. Science. 2003;301:336–338. [PubMed]
  • Bartel DP. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell. 2004;116:281–297. [PubMed]
  • Baulcombe D. RNA silencing in plants. Nature. 2004;431:356–363. [PubMed]
  • Meister G, Tuschl T. Mechanisms of gene silencing by double-stranded RNA. Nature. 2004;431:343–349. [PubMed]
  • Sontheimer EJ. Assembly and function of RNA silencing complexes. Nat Rev Mol Cell Biol. 2005;6:127–138. [PubMed]
  • Tomari Y, Zamore PD. Perspective: Machines for RNAi. Genes Dev. 2005;19:517–529. [PubMed]
  • Pasquinelli AE, Reinhart BJ, Slack F, Martindale MQ, Kuroda MI. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature. 2000;408:86–89. [PubMed]
  • Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T. Identification of novel genes coding for small expressed RNAs. Science. 2001;294:853–858. [PubMed]
  • Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T. Identification of tissue-specific microRNAs from mouse. Curr Biol. 2002;12:735–739. [PubMed]
  • Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T. New microRNAs from mouse and human. RNA. 2003;9:175–179. [PMC free article] [PubMed]
  • Lau NC, Lim LP, Weinstein EG, Bartel DP. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science. 2001;294:858–862. [PubMed]
  • Lee RC, Ambros V. An extensive class of small RNAs in Caenorhabditis elegans. Science. 2001;294:862–864. [PubMed]
  • Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B. miRNPs: A novel class of ribonucleoproteins containing numerous microRNAs. Genes Dev. 2002;16:720–728. [PMC free article] [PubMed]
  • Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP. MicroRNAs in plants. Genes Dev. 2002;16:1616–1626. [PMC free article] [PubMed]
  • Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D. MicroRNAs and other tiny endogenous RNAs in C. elegans. Curr Biol. 2003;13:807–818. [PubMed]
  • Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D. The small RNA profile during Drosophila melanogaster development. Dev Cell. 2003;5:337–350. [PubMed]
  • Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G. Numerous microRNPs in neuronal cells containing novel microRNAs. RNA. 2003;9:180–186. [PMC free article] [PubMed]
  • Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM. Computational and experimental identification of C. elegans microRNAs. Mol Cell. 2003;11:1253–1263. [PubMed]
  • Houbaviy HB, Murray MF, Sharp PA. Embryonic stem cell-specific MicroRNAs. Dev Cell. 2003;5:351–358. [PubMed]
  • Lai EC, Tomancak P, Williams RW, Rubin GM. Computational identification of Drosophila microRNA genes. Genome Biol. 2003;4:R42. [PMC free article] [PubMed]
  • Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S. The microRNAs of Caenorhabditis elegans. Genes Dev. 2003;17:991–1008. [PMC free article] [PubMed]
  • Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RHA. Phylogenetic shadowing and computational identification of human microRNA genes. Cell. 2005;120:21–24. [PubMed]
  • John B, Enright AJ, Aravin A, Tuschl T, Sander C. Human microRNAs targets. PLoS Biol. 2004;2:e363. [PMC free article] [PubMed]
  • Brennecke J, Stark A, Russell RB, Cohen SM. Principles of microRNA-target recognition. PLoS Biol. 2005;3:e85. [PMC free article] [PubMed]
  • Lim LP, Lau NC, Garrett-Engele P, Grimson A, Schelter JM. Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature. 2005;433:769–773. [PubMed]
  • Lee Y, Kim M, Han J, Yeom KH, Lee S. MicroRNA genes are transcribed by RNA polymerase II. EMBO J. 2004;23:4051–4060. [PMC free article] [PubMed]
  • Lee Y, Jeon K, Lee JT, Kim S, Kim VN. MicroRNA maturation: Stepwise processing and subcellular localization. EMBO J. 2002;21:4663–4670. [PMC free article] [PubMed]
  • Lee Y, Ahn C, Han J, Choi H, Kim J. The nuclear RNase III Drosha initiates microRNA processing. Nature. 2003;425:415–419. [PubMed]
  • Basyuk E, Suavet F, Doglio A, Bordonne R, Bertrand E. Human let-7 stem-loop precursors harbor features of RNase III cleavage products. Nucleic Acids Res. 2003;31:6593–6597. [PMC free article] [PubMed]
  • Yi R, Qin Y, Macara IG, Cullen BR. Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs. Genes Dev. 2003;17:3011–3016. [PMC free article] [PubMed]
  • Bohnsack MT, Czaplinski K, Gorlich D. Exportin 5 is a RanGTP-dependent dsRNA-binding protein that mediates nuclear export of pre-miRNAs. RNA. 2004;10:185–191. [PMC free article] [PubMed]
  • Lund E, Guttinger S, Calado A, Dahlberg JE, Kutay U. Nuclear export of microRNA precursors. Science. 2004;303:95–98. [PubMed]
  • Hutvagner G, McLachlan J, Pasquinelli AE, Balint E, Tuschl T. A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA. Science. 2001;293:834–838. [PubMed]
  • Grishok A, Pasquinelli AE, Conte D, Li N, Parrish S. Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing. Cell. 2001;106:23–34. [PubMed]
  • Ketting RF, Fischer SE, Bernstein E, Sijen T, Hannon GJ. Dicer functions in RNA interference and in synthesis of small RNA involved in developmental timing in C. elegans. Genes Dev. 2001;15:2654–2659. [PMC free article] [PubMed]
  • Schwarz DS, Hutvagner G, Du T, Xu Z, Aronin N. Asymmetry in the assembly of the RNAi enzyme complex. Cell. 2003;115:199–208. [PubMed]
  • Hutvagner G, Zamore PD. A microRNA in a multiple-turnover RNAi enzyme complex. Science. 2002;297:2056–2060. [PubMed]
  • Olsen PH, Ambros V. The lin-4 regulatory RNA controls developmental timing in Caenorhabditis elegans by blocking LIN-14 protein synthesis after the initiation of translation. Dev Biol. 1999;216:671–680. [PubMed]
  • Tomari Y, Zamore PD. MicroRNA biogenesis: Drosha can't cut it without a partner. Curr Biol. 2005;15:R61–64. [PubMed]
  • Denli AM, Tops BB, Plasterk RH, Ketting RF, Hannon GJ. Processing of primary microRNAs by the Microprocessor complex. Nature. 2004;432:231–235. [PubMed]
  • Gregory RI, Yan KP, Amuthan G, Chendrimada T, Doratotaj B. The Microprocessor complex mediates the genesis of microRNAs. Nature. 2004;432:235–240. [PubMed]
  • Han J, Lee Y, Yeom KH, Kim YK, Jin H. The Drosh-DGCR8 complex in primary microRNA processing. Genes Dev. 2005;18:3016–3027. [PMC free article] [PubMed]
  • Landthaler M, Yalcin A, Tuschl T. The human DiGeorge syndrome critical region gene 8 and its D. melanogaster homolog are required for miRNA biogenesis. Curr Biol. 2004;15:2162–2167. [PubMed]
  • Papp I, Mette MF, Aufsatz W, Daxinger L, Schauer SE. Evidence for nuclear processing of plant micro RNA and short interfering RNA precursors. Plant Physiol. 2003;132:1382–1390. [PMC free article] [PubMed]
  • Kurihara Y, Watanabe Y. Arabidopsis micro-RNA biogenesis through Dicer-like 1 protein functions. Proc Natl Acad Sci U S A. 2004;101:12753–12758. [PMC free article] [PubMed]
  • Vazquez F, Gasciolli V, Crete P, Vaucheret H. The nuclear dsRNA binding protein HYL1 is required for microRNA accumulation and plant development, but not posttranscriptional transgene silencing. Curr Biol. 2004;14:346–351. [PubMed]
  • Han MH, Goud S, Song L, Fedoroff N. The Arabidopsis double-stranded RNA-binding protein HYL1 plays a role in microRNA-mediated gene regulation. Proc Natl Acad Sci U S A. 2004;101:1093–1098. [PMC free article] [PubMed]
  • Bernstein E, Caudy AA, Hammond SM, Hannon GJ. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature. 2001;409:363–366. [PubMed]
  • Lee YS, Nakahara K, Pham JW, Kim K, He Z. Distinct roles for Drosophila Dicer-1 and Dicer-2 in the siRNA/miRNA silencing pathways. Cell. 2004;117:69–81. [PubMed]
  • Liu Q, Rand TA, Kalidas S, Du F, Kim HE. R2D2, a bridge between the initiation and effector steps of the Drosophila RNAi pathway. Science. 2003;301:1921–1925. [PubMed]
  • Okamura K, Ishizuka A, Siomi H, Siomi MC. Distinct roles for Argonaute proteins in small RNA-directed cleavage pathways. Genes Dev. 2004;18:1655–1666. [PMC free article] [PubMed]
  • Boutros M, Kiger AA, Armknecht S, Kerr K, Hild M. Genome-wide RNAi analysis of growth and viability in Drosophila cells. Science. 2004;303:832–835. [PubMed]
  • Lasko P. The Drosophila melanogaster genome: Translation factors and RNA binding proteins. J Cell Biol. 2000;150:F51–F56. [PMC free article] [PubMed]
  • Tabara H, Yigit E, Siomi H, Mello CC. The dsRNA binding protein RDE-4 interacts with RDE-1, DCR-1, and a DExH-box helicase to direct RNAi in C. elegans. Cell. 2002;109:861–871. [PubMed]
  • Schwarz DS, Tomari Y, Zamore PD. The RNA-induced silencing complex is a Mg2+-dependent endonuclease. Curr Biol. 2004;14:787–791. [PubMed]
  • Nicholson AW. The ribonuclease III superfamily: Forms and functions in RNA, maturation, decay, and gene silencing. In: Hannon GJ, editor. RNAi: A guide to gene silencing. Cold Spring Harbor Laboratory Press, Plainview (New York): 2003. pp. 149–174.
  • Tomari Y, Matranga C, Haley B, Martinez N, Zamore PD. A protein sensor for siRNA asymmetry. Science. 2004;306:1377–1380. [PubMed]
  • Peters GA, Hartmann R, Qin J, Sen GC. Modular structure of PACT: Distinct domains for binding and activating PKR. Mol Cell Biol. 2001;21:1908–1920. [PMC free article] [PubMed]
  • Zhang H, Kolb F, Jaskiewicz L, Westhof E, Filipowicz W. Single processing center models for human Dicer and bacterial RNase III. Cell. 2004;118:57–68. [PubMed]
  • Patel RC, Sen GC. PACT, a protein activator for the interferon-induced protein kinase, PKR. EMBO J. 1998;17:4379–4390. [PMC free article] [PubMed]
  • Gatignol A, Buckler-White A, Berkhout B, Jeang KT. Characterization of a human TAR RNA-binding protein that activates the HIV-1 LTR. Science. 1991;251:1597–1600. [PubMed]
  • Fierro-Monti I, Mathews MB. Proteins binding to duplexed RNA: One motif, multiple functions. Trends Biochem Sci. 2000;25:241–246. [PubMed]
  • Kaempfer R. RNA sensors: Novel regulators of gene expression. EMBO Rep. 2003;4:1043–1047. [PMC free article] [PubMed]
  • Saunders LR, Barber GN. The dsRNA binding protein family: Critical roles, diverse cellular functions. FASEB J. 2003;17:961–983. [PubMed]
  • Park H, Davies MV, Langland JO, Chang HW, Nam YS. TAR RNA-binding protein is an inhibitor of the interferon-induced protein kinase PKR. Proc Natl Acad Sci U S A. 1994;91:4713–4717. [PMC free article] [PubMed]
  • Clemens JC, Worby CA, Simonson-Leff N, Muda M, Maehama T. Use of double-stranded RNA interference in Drosophila cell lines to dissect signal transduction pathways. Proc Natl Acad Sci U S A. 2000;97:6499–6503. [PMC free article] [PubMed]
  • Kataoka Y, Takeichi M, Uemura T. Developmental roles and molecular characterization of a Drosophila homologue of Arabidopsis Argonaute1, the founder of a novel gene superfamily. Genes Cells. 2001;6:313–325. [PubMed]
  • Eckmann CR, Jantsch MF. Xlrbpa, a double-stranded RNA-binding protein associated with ribosomes and heterogeneous nuclear RNPs. J Cell Biol. 1997;138:239–253. [PMC free article] [PubMed]
  • Hammond SM, Boettcher S, Caudy AA, Kobayashi R, Hannon GJ. Argonaute2, a link between genetic and biochemical analyses of RNAi. Science. 2001;293:1146–1150. [PubMed]
  • Ishizuka A, Siomi MC, Siomi H. A Drosophila fragile X protein interacts with components of RNAi and ribosomal proteins. Genes Dev. 2002;16:2497–2508. [PMC free article] [PubMed]
  • Djikeng A, Shi H, Tschudi C, Shen S, Ullu E. An siRNA ribonucleoprotein is found associated with polyribosomes in Trypanosoma brucei. RNA. 2003;9:802–808. [PMC free article] [PubMed]
  • Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS. Identification of many microRNAs that copurify with polyribosomes in mammalian neurons. Proc Natl Acad Sci U S A. 2004;101:360–365. [PMC free article] [PubMed]
  • Pham JW, Pellino JL, Lee YS, Carthew RW, Sontheimer EJ. A Dicer-2-dependent 80s complex cleaves targeted mRNAs during RNAi in Drosophila. Cell. 2004;117:83–94. [PubMed]

Articles from PLoS Biology are provided here courtesy of Public Library of Science
PubReader format: click here to try


Related citations in PubMed

See reviews...See all...


Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...