• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of biochemjBJ Latest papers and much more!
Biochem J. Jun 1, 1994; 300(Pt 2): 295–298.
PMCID: PMC1138160

A novel human airway mucin cDNA encodes a protein with unique tandem-repeat organization.

Abstract

Highly specific affinity-purified polyclonal antibodies against deglycosylated human tracheobronchial mucin was used to select immunoreactive clones from a Uni-ZAP cDNA expression library prepared from normal human tracheal mRNA. The largest of three positive clones, designated pAM1, which reacted strongly with the polyclonal antibodies, was further characterized. Sequence analyses revealed a partial 941 bp cDNA that encoded a 313-amino-acid polypeptide. Bases 3-892 consisted of imperfect 41-nucleotide tandem repeats (CCAGGAGGGGACACCGGGTTCACGAGCTGCCCACGCCCTCT) that encoded a unique polypeptide with two types of consensus repeats, TSCPRPLQEGTRV and TSCPRPLQEGTPGSRAAHALSRRGHRVHELPTSSPGGDTGF. The overall composition of the deduced amino acid sequence matched that expected for a mucin protein core and is rich in serine, threonine, proline, glycine and alanine (approximately 51%). Northern blots probed with the mucin cDNA exhibited intense polydisperse hybridization bands with RNA isolated from normal human trachea and cystic-fibrosis bronchus. The data indicate that mucin encoded by clone pAM1 represents a unique type of peptide organization which has not been described in mucin cDNAs reported thus far.

Full text

Full text is available as a scanned copy of the original print version. Get a printable copy (PDF file) of the complete article (823K), or click on a page image below to browse page by page. Links to PubMed are also available for Selected References.

Images in this article

Click on the image to see a larger version.

Selected References

These references are in PubMed. This may not be the complete list of references from this article.
  • Gendler S, Taylor-Papadimitriou J, Duhig T, Rothbard J, Burchell J. A highly immunogenic region of a human polymorphic epithelial mucin expressed by carcinomas is made up of tandem repeats. J Biol Chem. 1988 Sep 15;263(26):12820–12823. [PubMed]
  • Gum JR, Byrd JC, Hicks JW, Toribara NW, Lamport DT, Kim YS. Molecular cloning of human intestinal mucin cDNAs. Sequence analysis and evidence for genetic polymorphism. J Biol Chem. 1989 Apr 15;264(11):6480–6487. [PubMed]
  • Gum JR, Hicks JW, Swallow DM, Lagace RL, Byrd JC, Lamport DT, Siddiki B, Kim YS. Molecular cloning of cDNAs derived from a novel human intestinal mucin gene. Biochem Biophys Res Commun. 1990 Aug 31;171(1):407–415. [PubMed]
  • Porchet N, Nguyen VC, Dufosse J, Audie JP, Guyonnet-Duperat V, Gross MS, Denis C, Degand P, Bernheim A, Aubert JP. Molecular cloning and chromosomal localization of a novel human tracheo-bronchial mucin cDNA containing tandemly repeated sequences of 48 base pairs. Biochem Biophys Res Commun. 1991 Mar 15;175(2):414–422. [PubMed]
  • Crepin M, Porchet N, Aubert JP, Degand P. Diversity of the peptide moiety of human airway mucins. Biorheology. 1990;27(3-4):471–484. [PubMed]
  • Toribara NW, Roberton AM, Ho SB, Kuo WL, Gum E, Hicks JW, Gum JR, Jr, Byrd JC, Siddiki B, Kim YS. Human gastric mucin. Identification of a unique species by expression cloning. J Biol Chem. 1993 Mar 15;268(8):5879–5885. [PubMed]
  • Bobek LA, Tsai H, Biesbrock AR, Levine MJ. Molecular cloning, sequence, and specificity of expression of the gene encoding the low molecular weight human salivary mucin (MUC7). J Biol Chem. 1993 Sep 25;268(27):20563–20569. [PubMed]
  • Dufosse J, Porchet N, Audie JP, Guyonnet Duperat V, Laine A, Van-Seuningen I, Marrakchi S, Degand P, Aubert JP. Degenerate 87-base-pair tandem repeats create hydrophilic/hydrophobic alternating domains in human mucin peptides mapped to 11p15. Biochem J. 1993 Jul 15;293(Pt 2):329–337. [PMC free article] [PubMed]
  • Shankar V, Naziruddin B, Reyes de la Rocha S, Sachdev GP. Evidence of hydrophobic domains in human respiratory mucins. Effect of sodium chloride on hydrophobic binding properties. Biochemistry. 1990 Jun 19;29(24):5856–5864. [PubMed]
  • Padhye NV, Naziruddin B, Desai VC, Reyes de la Rocha S, Sachdev GP. Physicochemical characterization of a minor mucin component from cystic fibrosis tracheobronchial secretions. Biochim Biophys Acta. 1991 Apr 29;1077(3):332–338. [PubMed]
  • Byrd JC, Lamport DT, Siddiqui B, Kuan SF, Erickson R, Itzkowitz SH, Kim YS. Deglycosylation of mucin from LS174T colon cancer cells by hydrogen fluoride treatment. Biochem J. 1989 Jul 15;261(2):617–625. [PMC free article] [PubMed]
  • Vaitukaitis JL. Production of antisera with small doses of immunogen: multiple intradermal injections. Methods Enzymol. 1981;73(Pt B):46–52. [PubMed]
  • Desai VC, Naziruddin B, Graves DC, Reyes de la Rocha S, Sachdev GP. Production and characterization of monoclonal antibodies to purified deglycosylated cystic fibrosis respiratory mucin: evidence for the presence of four immunologically distinct epitopes. Hybridoma. 1991 Apr;10(2):285–296. [PubMed]
  • Gum JR., Jr Mucin genes and the proteins they encode: structure, diversity, and regulation. Am J Respir Cell Mol Biol. 1992 Dec;7(6):557–564. [PubMed]
  • Gum JR, Jr, Hicks JW, Toribara NW, Rothe EM, Lagace RE, Kim YS. The human MUC2 intestinal mucin has cysteine-rich subdomains located both upstream and downstream of its central repetitive region. J Biol Chem. 1992 Oct 25;267(30):21375–21383. [PubMed]
  • Gendler SJ, Lancaster CA, Taylor-Papadimitriou J, Duhig T, Peat N, Burchell J, Pemberton L, Lalani EN, Wilson D. Molecular cloning and expression of human tumor-associated polymorphic epithelial mucin. J Biol Chem. 1990 Sep 5;265(25):15286–15293. [PubMed]

Articles from Biochemical Journal are provided here courtesy of The Biochemical Society

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

  • Gene
    Gene
    Gene links
  • Gene (nucleotide)
    Gene (nucleotide)
    Records in Gene identified from shared sequence links
  • GEO Profiles
    GEO Profiles
    Related GEO records
  • MedGen
    MedGen
    Related information in MedGen
  • Nucleotide
    Nucleotide
    Published Nucleotide sequences
  • OMIM
    OMIM
    OMIM record citing PubMed
  • Protein
    Protein
    Published protein sequences
  • PubMed
    PubMed
    PubMed citations for these articles
  • Substance
    Substance
    PubChem Substance links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...