![]() | ![]() |
Formats:
|
||||||||||||||||||||
Copyright © 2005, Cold Spring Harbor Laboratory Press Disclosing hidden transcripts: Mouse natural sense–antisense transcripts tend to be poly(A) negative and nuclear localized 1 Technology and Development Team for Mammalian Cellular Dynamics, BioResource Center (BRC), RIKEN Tsukuba Institute, Tsukuba, Ibaraki, Japan 305-0074 2 BioResource Information Division, BioResource Center (BRC), RIKEN Tsukuba Institute, Tsukuba, Ibaraki, Japan 305-0074 3 Graduate School of Life and Environmental Sciences, University of Tsukuba, Tsukuba, Ibaraki, Japan 305-0006 4 Laboratory for Genome Exploration Research Group, RIKEN Genomic Sciences Center (GSC), RIKEN Yokohama Institute, Tsurumi-ku, Yokohama, Kanagawa, Japan 230-0045 5 Genome Science Laboratory, RIKEN, Wako, Saitama, Japan 351-0198 6 Division of Genomic Information Resource Exploration, Science of Biological Supramolecular Systems, Yokohama City University, Graduate School of Integrated Science, Tsurumi-ku, Yokohama, Japan 230-0045 7Corresponding author. E-mail abe/at/rtc.riken.jp; fax 81-29-836-9199. Received August 18, 2004; Accepted January 26, 2005. This article has been cited by other articles in PMC.Abstract Genome-wide in silico analysis identified thousands of natural sense–antisense transcript (SAT) pairs in the mouse transcriptome. We investigated their expression using strand-specific oligo-microarray that distinguishes expression of sense and antisense RNA from 1947 SAT pairs. The majority of the predicted SATs are expressed at various steady-state levels in various tissues, and cluster analysis of the array data demonstrated that the ratio of sense and antisense expression for some of the SATs fluctuated markedly among these tissues, while the rest was unchanged. Surprisingly, further analyses indicated that vast amounts of multiple-sized transcripts are expressed from the SAT loci, which tended to be poly(A) negative, and nuclear localized. The tendency that the SATs are often not polyadenylated is conserved, even in the randomly chosen SAT genes in the plant Arabidopsis thaliana. Such common characteristics imply general roles of the SATs in regulation of gene expression. Recently, increasing numbers of natural antisense transcripts have been identified in a variety of eukaryotic organisms using large-scale transcriptome analysis. The sense–antisense transcript (SAT) pair is a pair of transcripts produced from the same locus on the chromosome, but from the DNA strands opposite each other. These include 2481 SAT pairs in mice (The FANTOM Consortium and The Riken Genome Exploration Research Group Phase I & II Team 2002; Kiyosawa et al. 2003), 1027 SATs in Drosophila melanogaster (Misra et al. 2002), 2667 SATs in humans (Yelin et al. 2003), and 601 SATs in rice (Osato et al. 2003). Whole-genome array expression analysis has also revealed ~7600 SATs (~30% of all annotated genes) in Arabidopsis thaliana (Yamada et al. 2003). These vast numbers prompt the notion that SATs may have regulatory roles in gene expression and/or RNA processing via the formation of double-stranded RNA (dsRNA) (Herbert 2004). On the other hand, small noncoding RNAs (ncRNA) have also drawn attention as regulators of gene expression. microRNAs (miRNA) are small (~22 nucleotides), processed antisense RNAs, which bind to sense transcripts, thereby blocking further translation of the sense strand RNA (Nelson et al. 2003). Small interfering RNAs (siRNA) are of similar size to miRNA, but are generated from longer dsRNA, a product of the sense and antisense RNA duplex (Nelson et al. 2003). siRNA is responsible for mRNA degradation of matched sequences and is also implicated in gene silencing at the transcriptional level (Vance and Vaucheret 2001; Hall et al. 2002; Volpe et al. 2002). Another type of small dsRNAs (20–21 nucleotides) is implicated in gene regulation via transcription-factor binding in a mechanism distinct from that of miRNA/siRNAs (Kuwabara et al. 2004). The relationships between thousands of natural antisense transcripts identified within the genome, and these small RNAs are yet to be determined. In mammals, a small cohort of longer antisense RNAs has been located within imprinted loci. One of these, Air, was proven via gene-targeting to be involved in the maintenance of the local imprint status (Sleutels et al. 2002). Although we now have massive amounts of data gleaned from genome/transcriptome analyses, the experimental evidence defining the extent of most SAT expression remains very limited; in part, because the majority of the described data have been obtained using in silico analysis exclusively. Here, we report actual transcriptional analyses of sense and antisense genes and show that these transcripts tend to be both poly(A) negative and nuclear localized. Results Expression analysis of SATs by Oligo DNA microarray To determine whether SATs are actually transcribed, we performed expression analysis of available mouse SATs by using custom-made oligo DNA (60-mer) chips that distinguish the expression of sense versus antisense transcripts. From 2481 pairs of SATs identified in mouse transcriptome (The FANTOM Consortium and The RIKEN Genome Exploration Research Group Phase I & II Team 2002), we chose those pairs that consisted of either FANTOM2 full-length cDNA or RefSeq sequences (2097 pairs of SATs). The final DNA sequences on the microarray for which unique 60-mer sequences were successfully chosen were 1947 SAT pairs for the microarray probes. These SAT sequences can be classified as “coding” or “noncoding” genes based on the gene annotation by the FANTOM Consortium (2002). These distinctions of each gene are shown in Supplemental Table 1. Of 1947 sense–antisense pairs, 943, 828, and 173 were coding/coding, coding/noncoding, and noncoding/noncoding pairs, respectively. The coding status of three genes could not be determined. Conventionally, sense transcripts often represent coding genes. In this study, however, we define the “sense” transcripts as those that map to the (+) strand of the published mouse genome assembly, whereas “antisense” transcripts are on the (–) strand, because we found both of the SAT pair genes corresponded to coding or noncoding in many cases. In addition, the coding status of each gene is still tentative in a strict sense. In our definition, sense does not necessarily indicate the protein-coding status of the transcript, nor does antisense imply ncRNA. We found that most of the sense and antisense genes are indeed expressed at various levels in various cells and tissues (Fig. 1
We next performed clustering analysis of the microarray data, in which the SATs pairs were grouped according to the log ratio of the expression levels for the sense and the antisense pairs (when both of the pairs consist of coding genes or noncoding genes only), or the coding and noncoding gene pairs (Fig. 2A–F
Northern hybridization analysis of selected SATs We next performed Northern analysis of six randomly chosen pairs of SATs. To distinguish the sense and antisense transcripts, we transcribed single-stranded riboprobes and used them in the analysis. The results from two SAT pairs are shown in Figures Figures33
In the second SAT pair (G430028I15, unknown EST; D930007L12, Metaxin1), G430028I15 appears to encode ncRNA. It is intriguing that the ncRNA probe again gave a strong hybridization smear on the total RNA blot, but not on the poly(A)+ blot (Fig. 4D To ascertain whether these banding patterns are not due to nonspecific cross hybridization to the RNA probes used, we designed 30-mer oligo DNA probes complementary to either 6330439J10/A230019L24 or G430028I15 (the probe positions indicated in Figs. Figs.3A3A
The SAT gene probes often detected many bands or strong hybridization smears in total RNA, but not in poly(A)+ RNA. These hybridization patterns were not specific to ncRNA, but appeared to be associated with the SAT loci in general. Of the six SAT pairs analyzed (6 SATs; 2 probes per SAT = 12 probes total), we found the smear hybridization pattern with eight (66.7%) probes, five of which came from protein-coding genes (Table 1).
Because we obtained different results with total RNA and poly(A)+ RNA, we prepared poly(A)+ and poly(A)– RNA from fibroblasts and repeated the Northern analysis. The transcripts revealed by the A230019L24 and G430028I15 probes occurred in the poly(A)– fraction, indicating that they were not polyadenylated (Fig. 5D,E Estimations of expression levels of SATs by dot blots As we detected strong hybridization signals for SATs on the Northern blots, we attempted to estimate the RNA expression levels of 6330439J10/A230019L24 and G430028I15/D930007L12 by quantitative dot blot analysis. 32P-labeled probes were hybridized to a serial concentration (50 ng, 100 ng, 250 ng, 500 ng, 1 μg, and 2.5 μg) of mouse brain RNA containing 40 pg/μg of in vitro-transcribed plant RNA as a spike control. Hybridization signal intensities changed proportionally to a serially diluted series of RNA samples for every probe used (Supplemental Fig. 1). With the dots of 1-μg RNA, we obtained the following hybridization intensities relative to that of β-actin: 6.1% (6330439J10), 10% (A230019L24), 104% (G430028I15), 20% (D930007L12). These intensity values approximately corresponded to 9, 14, 150, and 30 pg per 1 μg of mouse brain total RNA, respectively, based on the calibrations with a spike control. Identification of start sites of SATs As we found multiple transcripts of varying sizes for many of the SATs, we attempted to identify transcription start sites upstream of the G430028I15 gene using 5′ RACE. There are at least five start sites residing in the intron–exon region of Metaxin1 on the opposite strand of G430028I15 (Fig. 5F Global comparison of microarray data: Difference between Oligo dT and random priming methods Since the SATs are often localized in nucleus and not polyadenylated, we re-examined SAT expression by using the oligo microarray with a different cDNA priming method. The cDNA target was cyanine labeled with random nanomers this time, instead of the oligo dT primer used in the previous experiments. We reasoned that the results obtained with random nanomers would differ from the previous results if the majority of SATs are not polyadenylated. As expected, the random-priming method yielded increased signals only for the genes showing the hybridization smear on the Northern blots (Figs. 3B,C As described in the Methods section, our custom microarray contains 2697 probe sequences derived from ESTs that are unrelated to the SAT gene sequences. Homology search analysis showed that the EST sequences did not overlap with the SAT sequences used in this study (data not shown). Therefore, this EST set likely was derived from typical polyadenylated mRNA and could serve as a convenient control against the SATs. As expected, the sum of the signals detected by these EST probes was reduced markedly when random priming was used (Fig. 6
Cluster analysis of the expression ratio for the SAT pairs were again performed using the data obtained with random-primed targets (Fig. 2D,E,F Some of the plant SATs are also present in poly(A)- fraction To assess whether the SAT transcripts generally are enriched in the poly(A)– fraction in plants also, we conducted expression analyses of SATs identified by Seki and Shinozaki (pers. comm.; Seki et al. 2005) in the transcriptome of A. thaliana. We randomly chose four probe pairs from Arabidopsis SATs and hybridized them to total, poly(A)+, and poly(A)– RNA. Interestingly, seven of the eight transcripts were enriched in the poly(A)– fraction (data from two pairs shown in Fig. 7A,B
Discussion In this study, we present the first experimental evidence for the expression of SATs identified by genome-wide analyses in silico. The steady-state RNA levels of the SATs generally were high. In light of dot-blot hybridizations, we estimated the amounts of the noncoding transcripts, A230019L24 and G430028I15, to be ~10% and ~100% of the level of the β-actin RNA, respectively. More importantly, we disclosed several previously hidden characteristics of SAT transcripts; they generate multiple-sized transcripts that are not polyadenylated and tend to be nuclear localized. These traits suggest that SATs belong to a hitherto unknown category of transcripts. In this context, it is interesting to note that a smear hybridization pattern on the Northern blot with a noncoding gene probe was recently reported by Imamura et al. (2004). They identified an antisense RNA (Khps1a; antisense to the Sphk1 gene), which showed a hybridization smear ranging from 0.6 to 20 kb on Northern blots. The Sphk1–Khps1a pair was found to be included in our SAT pair collections. The processing pathways from primary transcript to mRNA or other classes of RNA are not yet fully understood. For example, ~95% of the RNA synthesized by RNA polymerase II in mammalian cells remains in the nucleus; only a minority is processed to mRNA (Jackson et al. 2000). The predominant population of RNA appears to lack polyadenylation and seems to be a poor substrate for splicing (Salditt-Georgieff and Darnell Jr. 1982). The role of this category of RNA and identity of its transcripts have eluded understanding for more than two decades. Our present study indicates that SATs share several characteristics with this class of RNA; both are present in vast quantities in the nucleus, and neither is polyadenylated. The biological functions of this category of RNA, including those of SATs, remain to be elucidated. The evolutionary conservation of SATs and their characteristics in plants and animals strongly suggest their importance in the regulation of gene expression. The information we present likely will promote better understanding of a new class of RNA that has been puzzling researchers for a long time. The regulatory roles played by the SAT genes may occur at the chromatin-domain level. Expression of imprinted genes is subjected to such domain-level regulation. Imprinted genes often are accompanied by a large antisense transcript, which is involved in the regional regulation of expression (e.g., Air–Igf2r, LIT1–KvLQT1) (Mitsuya et al. 1999; Sleutels et al. 2002). Nikaido et al. (2003) showed close relationships between SATs and imprinted genes. We also have discovered a number of novel SATs within imprinted loci (Kiyosawa and Abe 2002; Kiyosawa et al. 2003). Although the two SAT gene pairs we present in this study (6330439J10/A230019L24 and G430028I15/D930007L12) are not imprinted (data not shown, imprinting status of G430028I15 only could not be determined), complex transcription seems to be occurring at these loci; see, for example, the Metaxin1 locus. The intron sequence between exons 6 and 7 of Metaxin1 was reported to serve as a far-upstream enhancer element of Thrombospondin3 gene, which is downstream of the G430028I15 gene. There are four putative GC-boxes (Sp1-binding sites) in this region (marked as “G” in Fig. 5F Another interesting aspect of SATs is their relationship to RNA interference (RNAi). It is of great interest whether naturally occurring SATs can form dsRNA and become targets of RNAi machinery. Recently, dependence on natural RNAi via dsRNA formation in transposon silencing was demonstrated in Caenorhabditis elegans (Sijen and Plasterk 2003). In mice, when its expression was confined to nuclei, long dsRNA eventually produced siRNA and knocked down the expression of the corresponding protein-coding gene (Shinagawa and Ishii 2003). At least superficially, this situation resembles that produced with the SAT pairs, suggesting that some SATs may be involved in the repression of gene expression via natural RNAi. We actually detected small bands of <100 bases on the Northern blots with the probes only, from where the exons of the sense and antisense genes overlap, namely, where dsRNA is possibly formed (Fig. 5C Studies on poly(A)– RNAs has been limited, because conventional belief in molecular biology suggests that poly(A)+ mRNAs are major mediators in flows of genetic information. However, the information obtained from this study implies that some class of poly(A)– nuclear RNA may have important biological functions, and will promote a new field of research on the regulatory mechanisms mediated by the poly(A)– RNA. Methods DNA microarray experiment and analysis The sequences of 60-mer DNA specific to the sense and antisense genes were chosen by K.K. DNAFORM (Japan), and Agilent Technologies manufactured custom oligo DNA microarray chips by using this information. RNA was labeled and hybridized using Fluorescent Direct Label Kits (oligo dT-primed labeling) (Agilent Technologies), according to the manufacturer's protocols. For labeling with random nanomers, we used the CyScribe First-Strand cDNA Labeling Kit (Amersham). The RNA samples used for microarray experiments were from mouse ES cells, SL10 cells (fibroblast cell line), brain, heart, and testis. The total RNA of brain, heart, and testis for array experiments was purchased from Ambion. The total RNA of ES and fibroblast cells was isolated using Trizol reagent (Invitrogen). The same total RNA samples were reciprocally labeled with Cy3 or Cy5, hybridized to the oligo DNA on the chip, and dye-normalized, and processed signals were obtained using Feature Extraction software (Agilent Technologies). The custom oligo DNA microarray chip contained 2097 pairs of the sense–antisense genes and 592 pairs of nonantisense bidirectional genes (total 5078 genes), along with an additional 3013 genes unrelated to natural antisense analysis. These 3013 genes include 2697 EST sequences mentioned in the section of “Global Comparison of Microarray Data” of the results. For the Feature Extraction software to produce the processed signals, the data for all genes on the chip were used. For further analysis, the average of Cy3-labeled and Cy5-labeled processed signals was used as the processed signal of a particular gene expression. The correlation coefficient between the Cy3- and Cy5-labeled processed signals from oligo dT-primed samples was 0.951 (ES cells), 0.944 (fibroblast cells), 0.982 (brain), 0.972 (heart), and 0.973 (testis). The correlation coefficient of random primed samples was 0.923 (ES cells), 0.970 (fibroblast cells), 0.985 (brain), 0.983 (heart), and 0.970 (testis). The total gross signal on the chip in each hybridization experiment was adjusted to that with the ES cell sample, so that the relative differences in gene expression among cell lines and tissues could be compared with one another. The processed signals in the Supplemental data (Table S1) were these averaged signals. The microarray data were analyzed using cluster analysis implemented in the statistical package R. A MIAME-compliant description of our array analysis is provided as an online Supplemental document. The raw data of array experiments were deposited to the Gene Expression Omnibus (GEO) at the National Center for Biotechnology Information (NCBI) under the accession number of GSE2185 (http://www.ncbi.nlm.nih.gov/geo/). Northern hybridization Total RNA was isolated from fibroblast cells; the brain, heart (male/female mixed), and testis of C57BL/6J mice; and 3-week-old whole-rosette A. thaliana plants by using Trizol reagent (Invitrogen). mRNA was further prepared using the Oligotex-MAG mRNA Purification Kit (Takara). The fractions that did not bind to oligo dT beads were recovered, precipitated, and used as poly(A)– RNA samples. Nuclear and cytoplasmic RNA were isolated using the PARIS Protein and RNA Isolation System (Ambion). RNA was denatured with glyoxal prior to size fractionation by 1% agarose gel electrophoresis, blotted onto nylon membranes, hybridized to 32P-labeled probes, washed, and exposed to X-ray film by standard methods. The labeled probes were single-stranded RNAs generated by in vitro transcription, so that the strand specificity enabled us to distinguish the sense and antisense transcripts. Mouse full-length cDNA clones were used for the in vitro transcription: FANTOM clone ID G430028I15 (unknown EST; GenBank accession no. AK089957), D930007L12 (Metaxin1, AK086135), 1300008P06 (Ankyrin repeat structure-containing protein, AK004948), 2810025E10 (unknown EST, AK012809). As for dot-blot hybridization, the sequences excluding repeated elements were used for probes. The GenBank accession numbers of the A. thaliana full-length cDNA clones used for the Northern hybridization were AY065060, AF367349, BT006722, and AK117166. To obtain the probes for the –20 kb, +20 kb, and +40 kb regions of the Metaxin1 locus, DNA fragments were cloned into the pGEM-T Easy vector (Promega) after being amplified by PCR using C57BL/6J mouse genomic DNA and the following primer sequences: –20 kb, AGTCTTCTGTTGCCACTT GCCG and AGAGAAGGTGGCAGG TTGGCTG; +20 kb, ACACAGCAGTGA TAAGCCAGGG and TGCTTTACCTAT CCAGCACCC; and +40 kb, TGTGAG GAGGGAACCTCAAGGC and TGTCT CTTTTCCACTGTCTCCC. 32P-labeled probes were generated by in vitro transcription to detect the transcripts of the same direction as G430028I15. The sequences of the synthetic 30-mer DNA probes were CGAAGCCCAGAGGACAGGAGTTT GAGAGCC (FANTOM2 ID, 6330439J10), GGCTCTCAAACTCCT GTCCTCTGGGCTTCG (FANTOM2 ID, A230019L24), and AAT GACACCCTCTTTCCGCCTCTCCTTTTG (FANTOM2 ID, G430028I15). The sequences of 30-mer probes used for Fig. 3C cDNA synthesis, PCR, and 5′ RACE cDNA was synthesized with the SuperScript III RT System (Invitrogen) according to the manufacturer's instructions. 5′ RACE was performed with the GeneRacer Kit (Invitrogen) according to the manufacturer's instructions. EXTaq or LATaq (TaKaRa) was used in PCR reactions. The sequence used for the 3′ primer in the 5′ RACE reaction was GAGGCAAGGAGACCTCAGCAGG AAA, and its nested primer sequence was TGAGGCTAGTGTG GGGTTACTGTTCC (these sequences lie within the G430028I15 sequence). Acknowledgments We thank Misako Yuzuriha for her excellent technical assistance. We also thank Drs. Kazuo Shinozaki and Motoaki Seki for sharing A. thaliana sense and antisense gene data. Whole-rosette A. thaliana plants were kindly provided by Dr. Masatomo Kobayashi at RIKEN BRC. This work was supported in part by a Grant-in-aid of Ministry of Education, Science and Culture of Japan to H.K. and K.A. and by the Special Coordinating Funds for Promoting Science and Technology to K.A. Notes Article and publication are at http://www.genome.org/cgi/doi/10.1101/gr.3155905. Article published online before print in March 2005. Footnotes [Supplemental material is available online at www.genome.org. The expression data from this study have been submitted to Gene Expression Omnibus (GEO) at the National Center for Biotechnology Information (NCBI) under accession no. GSE2185.] References
Web site references
|
PubMed related articles
Your browsing activity is empty. Activity recording is turned off. |
|||||||||||||||||||
Nature. 2002 Dec 5; 420(6915):563-73.
[Nature. 2002]Genome Res. 2003 Jun; 13(6B):1324-34.
[Genome Res. 2003]Genome Biol. 2002; 3(12):RESEARCH0083.
[Genome Biol. 2002]Nat Biotechnol. 2003 Apr; 21(4):379-86.
[Nat Biotechnol. 2003]Genome Biol. 2003; 5(1):R5.
[Genome Biol. 2003]Nature. 2002 Dec 5; 420(6915):563-73.
[Nature. 2002]Curr Biol. 2001 Oct 2; 11(19):1553-8.
[Curr Biol. 2001]Proc Natl Acad Sci U S A. 1995 May 9; 92(10):4547-51.
[Proc Natl Acad Sci U S A. 1995]FASEB J. 2000 Feb; 14(2):242-54.
[FASEB J. 2000]Nature. 2000 Dec 14; 408(6814):796-815.
[Nature. 2000]Nature. 2002 Dec 5; 420(6915):520-62.
[Nature. 2002]Biochem Biophys Res Commun. 2004 Sep 17; 322(2):593-600.
[Biochem Biophys Res Commun. 2004]FASEB J. 2000 Feb; 14(2):242-54.
[FASEB J. 2000]Mol Cell Biol. 1982 Jun; 2(6):701-7.
[Mol Cell Biol. 1982]Hum Mol Genet. 1999 Jul; 8(7):1209-17.
[Hum Mol Genet. 1999]Nature. 2002 Feb 14; 415(6873):810-3.
[Nature. 2002]Genome Res. 2003 Jun; 13(6B):1402-9.
[Genome Res. 2003]Cytogenet Genome Res. 2002; 99(1-4):151-6.
[Cytogenet Genome Res. 2002]Genome Res. 2003 Jun; 13(6B):1324-34.
[Genome Res. 2003]Nature. 2003 Nov 20; 426(6964):310-4.
[Nature. 2003]Genes Dev. 2003 Jun 1; 17(11):1340-5.
[Genes Dev. 2003]J Biol Chem. 1998 Aug 21; 273(34):21816-24.
[J Biol Chem. 1998]