• We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Logo of iaiPermissionsJournals.ASM.orgJournalIAI ArticleJournal InfoAuthorsReviewers
Infect Immun. Nov 2001; 69(11): 6618–6624.
PMCID: PMC100035

Infection with Mycobacterium avium Differentially Regulates the Expression of Iron Transport Protein mRNA in Murine Peritoneal Macrophages

Editor: W. A. Petri, Jr.

Abstract

Iron is an important element for the growth of microorganisms as well as in the defense of the host by serving as a catalyst for the generation of free radicals via the Fenton/Haber-Weiss reactions. The iron transporter natural resistance-associated macrophage protein 1 (Nramp1) confers resistance to the growth of a variety of intracellular pathogens including Mycobacterium avium. Recently several other proteins that are involved in iron transport, including the highly homologous iron transporter Nramp2 and the transferrin receptor-associated protein HFE (hereditary hemochromatosis protein), have been described. The relationship of these proteins to host defense and to the growth of intracellular pathogens is not known. Here, we report that infection with M. avium differentially regulates mRNA expression of the proteins associated with iron transport in murine peritoneal macrophages. Both Nramp1 and Nramp2 mRNA levels increase following infection, while the expression of transferrin receptor mRNA decreases. The level of expression of HFE mRNA remains unchanged. The difference in the expression of the mRNA of these proteins following infection or cytokine stimulation suggests that they may play an important role in host defense by maintaining a delicate balance between iron availability for host defense and at the same time limiting iron availability for microbial growth.

Iron is an important element for the growth of microorganisms (42, 54, 55) as well as in the defense mounted by the host (11, 12, 35, 58). Pathogens secrete exochelins and siderophores to capture iron from mammalian hosts (54, 56). At the same time, the host attempts to limit the availability of iron to suppress the growth of a variety of microorganisms (5, 57). During infection, the level of iron in serum decreases, the import of iron from the intestinal lumen into the circulation decreases, the expression of transferrin receptors by host macrophages and other cells decreases, and the production of reactive nitrogen intermediates further sequesters the available iron (13, 17, 29, 38, 47). These changes in the availability of iron, which ultimately affect the production of red blood cells, have been referred to as an anemia of infection (13, 32).

Recently, several proteins that play important roles in controlling the availability of iron in mammalian hosts have been described. These include Nramp1, the natural resistance-associated protein (4, 21, 24) that is member of the solute carrier (SLC11A1) family of ion transporters (30). Work by us (33) and by Blackwell et al. (4) has shown that Nramp1 is an antiporter, expressed on phagosomes and primary phagolysosomes (26, 46), that transports iron into the phagosome (33), where it catalyzes the Haber-Weiss reaction (60). This results in an increase in the production of highly microbiocidal hydroxyl radicals. Another protein, termed DMT-1 (divalent metal ion transporter) (1) or DCT-1 (divalent cation transporter) (27), was identified by positional cloning and shown to be associated with microcytic anemia in mice (20, 25). This protein, which was initially cloned from the mk/mk mice and shown to have 78% homology to Nramp1, has also been referred to as Nramp2. The protein is expressed primarily in intestinal epithelial cells and transports iron from the intestinal lumen into blood circulation (10, 19, 59). Finally, HFE is a nonclassical major histocompatibility complex class I protein with an associated β2-microglobulin (14, 15, 18). A mutation in HFE leads to hereditary hemochromatosis (iron overload disease). The mutation is an S282Y mutation and occurs in the alpha 3 domain (15, 31). The mutated cysteine disrupts the association with β2-microglobulin, resulting in an unstable protein. The function of HFE is to regulate the binding of transferrin by the transferrin receptor (TfR) (31, 44, 49). Association of HFE with TfR limits the amount of transferrin that can be transported into cell (45). Without HFE, transferrin binds to its receptors and is transported into cells, thus causing iron overload. HFE is expressed in virtually all tissues and is highly expressed in intestinal epithelial cells as well as in circulating monocytes and granulocytes and in tissue macrophages (41).

Given the importance of iron to the invading pathogen and its role in homeostasis as well as its importance in host defense, we sought to understand how the expression of these proteins is regulated on infection with the intracellular pathogen Mycobacterium avium. Our results indicate that a complex relationship exists between the host cell and the pathogen that results in changes in the expression of Nramp1, Nramp2, and TfR. The level of HFE remained relatively constant throughout the course of infection.

MATERIALS AND METHODS

Mice.

Male BALB/c mice were purchased from Harlan Sprague-Dawley (Indianapolis, Ind.) when 4 to 6 weeks of age and given food and water ad libitum. The mice were used as macrophage donors when 6 to 10 weeks old.

Reagents.

Iscove's modified Dulbecco's medium (IMDM), phosphate-buffered saline, and penicillin/streptomycin were purchased from Life Technologies (Gaithersburg, Md.). Fetal bovine serum was purchased from Harlan Bioproducts for Science (Indianapolis, Ind.). Recombinant mouse gamma interferon (IFN-γ) was also purchased from Life Technologies, while bacterial lipopolysaccharide (LPS; Escherichia coli O111:B4) and recombinant mouse tumor necrosis factor alpha (TNF-α) were obtained from Sigma (St. Louis, Mo.). Recombinant mouse interleukin-1α (IL-1α) and granulocyte-macrophage colony-stimulating factor (GM-CSF) were purchased from R&D Systems (Minneapolis, Minn.). NG-monomethyl-l-arginine (NMMA) was from Calbiochem (La Jolla, Calif.). [α-32P]UTP (3,000 Ci/mmol) was obtained from Amersham (Piscataway, N.J.). All reagents contained less than 0.03 ng of LPS per ml. To minimize contamination by environmental LPS, baked utensils, disposable plasticware, and pyrogen-free water were used during the preparation of buffers and reagents.

Cell culture.

Mouse peritoneal macrophages were elicited by intraperitoneal injection of 4% sterile thioglycollate medium (Difco, Detroit, Mich.) 3 days previously. The macrophages were harvested by lavage using phosphate-buffered saline washed and plated at 6 × 106 cells per well in six-well culture plates in complete IMDM medium (10% fetal bovine serum 100 U of penicillin per ml, 100 μg of streptomycin per ml) at 37°C in 5% CO2 in air. After overnight culture, nonadherent cells were washed away with IMDM and the macrophage monolayer was infected with M. avium (ATCC 35712) at an 8:1 bacterium-to-macrophage ratio in complete IMDM without antibiotics or stimulated as described in the text. Prior to use, the bacteria were grown in Middlebrook 7H9 medium and stored as 1-ml aliquots at −70°C until use. The number of bacteria was confirmed by plate count on 7H11 agar plates supplemented with oleic acid-albumin-dextrose complex (OADC; Difco).

Construction of DNA plasmids of Nramp2, TfR, and HFE.

The mRNA sequences for murine Nramp2, TfR, and HFE were obtained from GenBank (accession numbers: L33415 for Nramp2, X57349 for TfR, and NM010424 for HFE). The reverse transcription-PCR (RT-PCR) primers are as follows: for Nramp2, forward (887) 5′TCAAGTCTAGACAGGTGAATCG3′ and reverse (1620) 5′GGTCAAATAAGCCACGCTAAC3′; for TfR, forward (253) 5′TACCTGGGCTATTGTAAGCGT3′ and reverse (986) 5′GATGACTGAGATGGCGGAAAC3′; and for HFE, forward (397) 5′CTGGACCATCATGGGCAACTA3′ and reverse (791) 5′GACACCTTAGAGAGGTCCCCGTAG3′. Briefly, the cDNA fragments of Nramp2, TfR, and HFE were amplified by RT-PCR with 1 to 2 μg of RAW264.7 macrophage total RNA using a Titan One Tube RT-PCR kit from Roche (Indianapolis, Ind.) as specified by the manufacturer. The RT-PCR products were confirmed by electrophoresis in 1.5% agarose gels. The cDNA fragments of each gene were then subcloned into a pGEM-T Easy vector from Promega (Madison, Wis.) The plasmids were then transformed into DH5α-competent E. coli cells (Life Technologies) and selected for ampicillin resistance. Resistant clones were grown in Luria-Bartani broth with ampicillin, and plasmid DNA was isolated using the High Pure plasmid isolation kit from Roche. The orientation of all the plasmids was confirmed by sequencing from the T7 primer site (Ohio State University Sequencing Facility). Construction of a plasmid containing the DNA sequence for glyceraldehyde phosphate dehydrogenase (GAPDH) has been described elsewhere by us (48). The Nramp1 probe was derived by digesting a full-length Nramp1 cDNA clone with BglI and XbaI. The resulting fragment, nucleotides 858 to 1057, was gel purified and subcloned into pBluescript SK(−). The isolated plasmids containing the cDNA inserts for Nramp1, Nramp2, TfR, HFE, and GAPDH were linearized by cutting with XbaI, BamHI, HindIII, PstI, and HindIII, respectively. The linearized plasmid DNAs were purified separately on 1.5% agarose gels and recovered by using the Concert Rapid Gel extraction system (Life Technologies).

RPA.

Total-mouse RNA was extracted using the RNAqueous kit (Ambion, Austin, Tex.) as specified by the manufacturer. A total of 6 to 20 μg of RNA was used for each RNase protection assay (RPA) sample. A mixture of purified linearized plasmid DNAs was used as a template to synthesize radiolabeled RNA probes using the RiboQuant in vitro transcription kit (BD PharMingen, San Diego, Calif.) with minor modifications. A total of 900,000 cpm of probe was used for every 10 μg of total RNA. The RPA was performed using the RiboQuant RPA kit (BD PharMingen). Denatured RNA samples were run on a 6% acrylamide gel. Dried gels were exposed to Kodak MR film for various periods depending on the efficiency of labeling.

Data analysis.

All films were scanned and intensities were measured using the SigmaScanPro 4 software (SPSS Science, Chicago, Ill.). The data were normalized to GAPDH and expressed as the percentage of unstimulated cells. The results were analyzed by analysis of variance (ANOVA).

RESULTS

Infection with M. avium stimulates the expression of Nramp proteins.

The results in Fig. Fig.11 show that infection of peritoneal macrophages with M. avium resulted in an increase in both Nramp1 and Nramp2 mRNA levels. The increase in the Nramp2 mRNA level occurred within 2 h of infection and reached its peak within 8 h. The increase in the Nramp1 mRNA level occurred at 8 h after infection and reached its peak by 20 h. The levels of both Nramp1 and Nramp2 mRNA remained relatively constant thereafter. In contrast to the increase in the expression of Nramp1 and Nramp2 mRNA, the expression of the TfR mRNA gradually decreased following infection with the mycobacterium (Fig. (Fig.1).1). There was little change in the level of HFE mRNA in peritoneal macrophages.

FIG. 1
Time course of the effect of M. avium stimulation on mRNA levels of iron transport proteins in thioglycollate-elicited murine peritoneal macrophages. Total RNA was extracted after macrophages were stimulated with M. avium (M. a.) for the different periods. ...

Cycloheximide superinduces Nramp2 mRNA.

The addition of cycloheximide (CHX) to cultures of BALB/c thioglycollate-elicited peritoneal macrophages did not affect the expression of Nramp1 mRNA (Fig. (Fig.2).2). However, CHX superinduced Nramp2 mRNA. Infection of macrophages with M. avium did not result in a further increase in Nramp2 induction.

FIG. 2
Effect of CHX on the expression of mRNA of proteins associated with iron transport. BALB/c thioglycollate-elicited peritoneal macrophages were treated with CHX (10 μg/ml) for 60 min before being infected with M. avium. After 4 h, total RNA was ...

IFN-γ treatment differentially affects mRNA expression of the iron transport proteins.

Treatment of thioglycollate-elicited peritoneal macrophages with IFN-γ resulted in a decrease in the expression of TfR mRNA (Fig. (Fig.3,3, top panel). The decline in TfR expression was apparent within 8 h following the addition of 100 U of IFN-γ per ml. The level of HFE mRNA, which increased by 30% initially, returned to basal levels within 8 h. IFN-γ resulted in a decrease in Nramp2 mRNA, while the level of Nramp1 mRNA was not affected. Infection of IFN-γ-primed cells with M. avium resulted in a more rapid decline in TfR expression as well as a decrease in HFE mRNA expression (Fig. (Fig.3,3, middle and bottom panels). Infection of IFN-γ-primed macrophages with M. avium reversed the inhibitory effect of IFN-γ on Nramp2 mRNA levels. The increase in Nramp2 mRNA expression in IFN-γ primed cells following M. avium infection was similar to that observed in cells that had been infected with M. avium but not pretreated with IFN-γ. In contrast, the expression of Nramp1 mRNA increased in IFN-γ primed macrophages following M. avium infection, but not at the level attained by infecting the cells with M. avium alone.

FIG. 3
Effect of IFN-γ on mRNA expression of iron transport proteins. (Top) BALB/c thioglycollate-elicited peritoneal macrophages were stimulated with IFN-γ (100 U/ml) in complete IMDM for the various times. Total RNA was extracted for RPA. Data ...

Treatment of macrophages with proinflammatory cytokines increases the expression of Nramp 1 and Nramp 2 mRNA.

The results in Fig. Fig.44 show that treatment of thioglycollate-elicited peritoneal macrophages with LPS or with TNF-α stimulated an increase in Nramp1 and Nramp2 mRNA levels while decreasing the expression of TfR mRNA. The expression of HFE mRNA decreased following stimulation of the cells with GM-CSF, TNF-α, or LPS but was not affected by IL-1α. Similarly, IL-1α did not affect the expression of the other iron transport protein mRNAs. GM-CSF also did not affect the expression of Nramp1 and Nramp2 mRNA but did decrease the expression of TfR mRNA.

FIG. 4
Effect of LPS and proinflammatory cytokines on iron transport protein mRNA expression. BALB/c thioglycollate-elicited peritoneal macrophages were stimulated with LPS (1 μg/ml), recombinant murine TNF-α (25 ng/ml), IL-1α (100 ng/ml), ...

Iron increases the expression of Nramp1 but not Nramp2 mRNA.

The addition of iron citrate to peritoneal macrophage cultures resulted in a decrease in TfR mRNA expression and in a concomitant increase in Nramp1 mRNA expression (Fig. (Fig.5).5). The levels of Nramp2 and HFE mRNA remained unchanged by the addition of iron. The addition of M. avium to the iron-treated cells resulted in an increase in Nramp2 mRNA expression that is consistent with the changes we observed following the addition of M. avium alone (data not shown). M. avium infection of iron-treated cells also resulted in a decrease in TfR and HFE mRNA expression.

FIG. 5
Effect of Fe on the expression of iron transport protein mRNA. The dose response of ferric citrate on mRNA expression in BALB/c thioglycolate-elicited peritoneal macrophages is shown. Macrophages were cultured in complete IMDM overnight followed by IMDM ...

DISCUSSION

The results of this investigation indicate that infection of macrophages with the intracellular bacterium M. avium induced the expression of mRNA of both Nramp2 and Nramp1, members of the divalent cation transport family of proteins. At the same time, the synthesis and expression of TfR mRNA decreased. Nramp2 mRNA induction occurred several hours prior to Nramp1 mRNA induction. Infection, as well as activation of macrophages, resulted in a decrease in TfR mRNA expression.

TfRs and HFE become associated in a pre-Golgi compartment and undergo similar posttranslational modification during intracellular transport to the surface (16, 48). They remain associated on the cell surface and are internalized via coated pits (17, 36, 40). HFE forms complexes with TfR in duodenal epithelial cells (17, 49) and thus down regulates the absorption of iron by TfR-transferrin internalization (45). HFE reduces the number of transferrin binding sites on the cell surface by its physical interaction with the TfR (44). The association of TfR with HFE may also prevent the internalization of iron-bound transferrin (45). Recent studies have shown that HFE cocrystalizes with both TfR and Nramp2 (3). This suggests that once the transferrin-TfR complex is internalized, acidification of the endosome results in the release of transferrin-bound iron, which is then transported to the cell cytosol by Nramp2. In contrast, Nramp1, which is expressed exclusively on phagosomes, transports iron into the phagosome (33).

It would appear that the differential regulation of mRNAs of these iron transport proteins by M. avium infection in thioglycolate-elicited peritoneal macrophages may provide the cell with sufficient quantities of iron early in the infection to generate antimicrobial effector molecules, while, later in the infection, limiting available iron for the growth of surviving microorganisms. Thus, the early increase in Nramp2 mRNA expression while TfR mRNA levels are still high suggests that more Nramp2 proteins would be available to transport iron into the cytoplasm. As the infection progresses, the decrease in TfR mRNA expression, together with constant levels of HFE mRNA, suggests that less iron is entering the cells via this transport route. Initially, this occurs because there are fewer receptors to bind to iron containing transferrin. Also, the relative increase in the ratio of HFE to TfR mRNA further suggests that the TfRs that are expressed may be prevented from binding to transferrin by their association with HFE. At this critical juncture in the host-microbe interaction, little transferrin-associated iron is available within the cell to stimulate the growth of the surviving microorganisms. At the same time, however, the host cells finds itself starved of an essential supply of biologically active iron to mediate the generation of free radicals necessary to eliminate the intracellular pathogens. Thus, the late increase in Nramp1 mRNA levels may compensate for the decrease in available iron.

Our observations that both M. avium infection and treatment of the cells with IFN-γ, independently and in combination, resulted in a decrease in TfR mRNA expression are similar to observations made by others regarding TfR expression and mRNA stability in macrophages (28, 39, 53). Also, treatment of macrophages with IFN-γ results in a decrease in TfR expression, which leads to decrease in the concentration of intracellular iron sufficient to inhibit the growth of Legionella pneumophila (8). This inhibition is completely reversed by the addition of iron (9).

Two alternatively spliced isoforms of Nramp2 mRNA have been identified in humans and in mice (40, 51). This is not apparent in our study because our probe consisted of the mRNA sequence from bp 887 to 1620, which terminated immediately 5′ to the alternative splicing site. Nevertheless, our results are similar to those of Wardrop and Richardson (52), who also found that LPS stimulation resulted in an increase in Nramp2 mRNA expression. Both of our observations suggest that Nramp2 mRNA is regulated to maintain the availability of iron in the cell. Since transferrin-mediated iron uptake is lowered, Nramp2 mRNA expression is increased in an attempt to restore the levels of biologically active iron. However, iron does not directly regulate Nramp2 mRNA levels, since both our observations and those of Wardrop and Richardson (52) have found that addition of iron to macrophage cultures does not result in an increase in Nramp2 mRNA expression even though the major isoform of Nramp2 mRNA contains an iron response element in its 3′ untranslated region that has been shown to be capable of binding the iron response protein (IRP) (51). We have not, however, been able to identify an iron response element associated with the 3′ untranslated region of Nramp1. The expression of Nramp2 but not Nramp1 mRNA was increased following the addition of CHX to the cells. This superinduction indicates that repressor proteins, whose synthesis is inhibited by CHX, may be controlling the level of Nramp2 mRNA.

We did not find that IFN-γ significantly increased the expression of Nramp1. This observation is different from that which we have previously reported for splenic macrophages (6, 7). Others have also reported that peritoneal cells constitutively express Nramp1 (2, 23). Splenic macrophages do not (6, 7). This difference in the basal level of expression between the macrophages from anatomically different compartments probably accounts for the different responses to IFN-γ.

We have found important differences in the regulation of expression of Nramp1 and Nramp2 mRNA in murine macrophages. While the expression of both is induced following infection with M. avium, the synthesis of Nramp2 mRNA appears to be actively repressed, since the addition of CHX resulted in an increase in mRNA that was not observed for Nramp1. Furthermore, we found that iron increased the expression of Nramp1 mRNA while not affecting the expression of Nramp2 mRNA by macrophages. This observation is similar to that reported by Baker et al. (2) suggesting that Nramp1 might autoregulate its own expression. Studies are in progress to determine how infection with M. avium differentially regulates the expression of these iron transport proteins in macrophages.

ACKNOWLEDGMENTS

We thank Tianyi Wang for helpful discussion and technical advice.

This work is supported by grants DK-57667, AI-42901, and HL-59795 from the National Institutes of Health to B.S.Z. and W.P.L.

REFERENCES

1. Andrews N C. The iron transporter DMT1. Int J Biochem Cell Biol. 1999;31:991–994. [PubMed]
2. Baker S T, Barton C H, Biggs T E. A negative autoregulatory link between Nramp1 function and expression. J Leukoc Biol. 2000;67:501–507. [PubMed]
3. Bennett M J, Lebron J A, Bjorkman P J. Crystal structure of the hereditary haemochromatosis protein HFE complexed with transferrin receptor. Nature. 2000;403:46–53. [PubMed]
4. Blackwell J M, Searle S, Goswami T, Miller E N. Understanding the multiple functions of Nramp1. Microbes Infect. 2000;2:317–321. [PubMed]
5. Brock J H, Mulero V. Cellular and molecular aspects of iron and immune function. Proc Nutr Soc. 2000;59:537–540. [PubMed]
6. Brown D H, Lafuse W P, Zwilling B S. Stabilized expression of mRNA is associated with mycobacterial resistance controlled by Nramp1. Infect Immun. 1997;65:597–603. [PMC free article] [PubMed]
7. Brown D H, LaFuse W, Zwilling B S. Cytokine-mediated activation of macrophages from Mycobacterium bovis BCG-resistant and -susceptible mice: differential effects of corticosterone on antimycobacterial activity and expression of the Bcg gene (candidate Nramp) Infect Immun. 1995;63:2983–2988. [PMC free article] [PubMed]
8. Byrd T F, Horwitz M A. Interferon gamma-activated human monocytes downregulate transferrin receptors and inhibit the intracellular multiplication of Legionella pneumophila by limiting the availability of iron. J Clin Investig. 1989;83:1457–1465. [PMC free article] [PubMed]
9. Byrd T F, Horwitz M A. Lactoferrin inhibits or promotes Legionella pneumophila intracellular multiplication in nonactivated and interferon gamma-activated human monocytes depending upon its degree of iron saturation. Iron-lactoferrin and nonphysiologic iron chelates reverse monocyte activation against Legionella pneumophila. J Clin Investig. 1991;88:1103–1112. [PMC free article] [PubMed]
10. Canonne-Hergaux F, Gruenheid S, Ponka P, Gros P. Cellular and subcellular localization of the Nramp2 iron transporter in the intestinal brush border and regulation by dietary iron. Blood. 1999;93:4406–4417. [PubMed]
11. Conrad M E, Umbreit J N. Iron absorption and transport—an update. Am J Hematol. 2000;64:287–298. [PubMed]
12. Conrad M E, Umbreit J N, Moore E G. Iron absorption and transport. Am J Med Sci. 1999;318:213–229. [PubMed]
13. Domachowske J B. The role of nitric oxide in the regulation of cellular iron metabolism. Biochem Mol Med. 1997;60:1–7. [PubMed]
14. Ehrlich R, Lemonnier F A. HFE—a novel nonclassical class I molecule that is involved in iron metabolism. Immunity. 2000;13:585–588. [PubMed]
15. Feder J N, Gnirke A, Thomas W, Tsuchihashi Z, Ruddy D A, Basava A, Dormishian F, Domingo R, Jr, Ellis M C, Fullan A, Hinton L M, Jones N L, et al. A novel MHC class I-like gene is mutated in patients with hereditary haemochromatosis. Nat Genet. 1996;13:399–408. [PubMed]
16. Feder J N, Tsuchihashi Z, Irrinki A, Lee V K, Mapa F A, Morikang E, Prass C E, Starnes S M, Wolff R K, Parkkila S, Sly W S, Schatzman R C. The hemochromatosis founder mutation in HLA-H disrupts beta2-microglobulin interaction and cell surface expression. J Biol Chem. 1997;272:14025–14028. [PubMed]
17. Feder J N, Penny D M, Irrinki A, Lee V K, Lebron J A, Watson N, Sigal E, Tsuchihashi Z, Bjorkman P J, Schatzman R C. The hemochromatosis gene product complexes with the transferrin receptor and lowers its affinity for ligand binding. Proc Natl Acad Sci USA. 1998;95:1472–1477. [PMC free article] [PubMed]
18. Felitti V J, Beutler E. New developments in hereditary hemochromatosis. Am J Med Sci. 1999;318:257–268. [PubMed]
19. Fleet J C. Identification of Nramp2 as an iron transport protein: another piece of the intestinal iron absorption puzzle. Nutr Rev. 1998;56:88–89. [PubMed]
20. Fleming M D, Trenor C C, Su M A, Foernzler D, Beier D R, Dietrich W F, Andrews N C. Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nat Genet. 1997;16:383–386. [PubMed]
21. Gomes M S, Appelberg R. Evidence for a link between iron metabolism and Nramp1 gene function in innate resistance against Mycobacterium avium. Immunology. 1998;95:165–168. [PMC free article] [PubMed]
22. Goswami T, Bhattacharjee A, Babal P, Searle S, Moore E, Li M, Blackwell J M. Natural-resistance-associated macrophage protein 1 is an H+/bivalent cation antiporter. Biochem J. 2001;354:511–519. [PMC free article] [PubMed]
23. Govoni G, Gauthier S, Billia F, Iscove N N, Gros P. Cell-specific and inducible Nramp1 gene expression in mouse macrophages in vitro and in vivo. J Leukoc Biol. 1997;62:277–286. [PubMed]
24. Govoni G, Gros P. Macrophage NRMAP1 and its role in resistanve to microbial infection. Inflamm Res. 1998;47:277–284. [PubMed]
25. Gruenheid S, Cellier M, Vidal S, Gros P. Identification and characterization of a second mouse Nramp gene. Genomics. 1995;25:514–525. [PubMed]
26. Gruenheid S, Pinner E, Desjardins M, Gros P. Natural resistance to infection with intracellular pathogens: the Nramp1 protein is recruited to the membrane of the phagosome. J Exp Med. 1997;185:717–730. [PMC free article] [PubMed]
27. Gunshin H, Mackenzie B, Berger U V, Gunshin Y, Romero M F, Boron W F, Nussberger S, Gollan J L, Hediger M A. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature. 1997;388:482–488. [PubMed]
28. Hamilton T A, Gray P W, Adams D O. Expression of the transferrin receptor on murine peritoneal macrophages is modulated by in vitro treatment with interferon gamma. Cell Immunol. 1984;89:478–488. [PubMed]
29. Hentze M W, Kuhn L C. Molecular control of vertebrate iron metabolism: mRNA-based regulatory circuits operated by iron, nitric oxide, and oxidative stress. Proc Natl Acad Sci USA. 1996;93:8175–8182. [PMC free article] [PubMed]
30. Horin P, Matiasovic J. Two polymorphic markers for the horse SLC11A1 (NRAMP1) gene. Anim Genet. 2000;31:152. [PubMed]
31. Jazwinska E C. Hemochromatosis: a genetic defect in iron metabolism. Bioessays. 1998;20:562–568. [PubMed]
32. Jurado R L. Iron, infections, and anemia of inflammation. Clin Infect Dis. 1997;25:888–895. [PubMed]
33. Kuhn D E, Baker B D, Lafuse W P, Zwilling B S. Differential iron transport into phagosomes isolated from the RAW264.7 macrophage cell lines transfected with Nramp1Gly169 or Nramp1Asp169. J Leukoc Biol. 1999;66:113–119. [PubMed]
34. Kuhn D E, Lafuse W P, Zwilling B S. Iron transport into Mycobacterium avium-containing phagosomes from an Nramp1(Gly169)-transfected RAW264.7 macrophage cell line. J Leukoc Biol. 2001;69:43–49. [PubMed]
35. Kuhn L C. Iron and gene expression: molecular mechanisms regulating cellular iron homeostasis. Nutr Rev. 1998;56:S11–19. , S54–S75. [PubMed]
36. Lebron J A, Bennett M J, Vaughn D E, Chirino A J, Snow P M, Mintier G A, Feder J N, Bjorkman P J. Crystal structure of the hemochromatosis protein HFE and characterization of its interaction with transferrin receptor. Cell. 1998;93:111–123. [PubMed]
37. Lee P L, Gelbart T, West C, Halloran C, Beutler E. The human Nramp2 gene: characterization of the gene structure, alternative splicing, promoter region and polymorphisms. Blood Cells Mol Dis. 1998;24:199–215. [PubMed]
38. Miller R A, Britigan B E. Role of oxidants in microbial pathophysiology. Clin Microbiol Rev. 1997;10:1–18. [PMC free article] [PubMed]
39. Pantopoulos K, Hentze M W. Nitric oxide signaling to iron-regulatory protein: direct control of ferritin mRNA translation and transferrin receptor mRNA stability in transfected fibroblasts. Proc Natl Acad Sci USA. 1995;92:1267–1271. [PMC free article] [PubMed]
40. Parkkila S, Waheed A, Britton R S, Bacon B R, Zhou X Y, Tomatsu S, Fleming R E, Sly W S. Association of the transferrin receptor in human placenta with HFE, the protein defective in hereditary hemochromatosis. Proc Natl Acad Sci USA. 1997;94:13198–13202. [PMC free article] [PubMed]
41. Parkkila S, Parkkila A K, Waheed A, Britton R S, Zhou X Y, Fleming R E, Tomatsu S, Bacon B R, Sly W S. Cell surface expression of HFE protein in epithelial cells, macrophages, and monocytes. Haematologica. 2000;85:340–345. [PubMed]
42. Ratledge C, Dover L G. Iron metabolism in pathogenic bacteria. Annu Rev Microbiol. 2000;54:881–941. [PubMed]
43. Ryan L K, Golenbock D T, Wu J, Vermeulen M W. Characterization of proinflammatory cytokine production and CD14 expression by murine alveolar macrophage cell lines. In Vitro Cell Dev Biol Anim. 1997;33:647–653. [PubMed]
44. Salter-Cid L, Brunmark A, Li Y, Leturcq D, Peterson P A, Jackson M R, Yang Y. Transferrin receptor is negatively modulated by the hemochromatosis protein HFE: implications for cellular iron homeostasis. Proc Natl Acad Sci USA. 1999;96:5434–5439. [PMC free article] [PubMed]
45. Salter-Cid L, Brunmark A, Peterson P A, Yang Y. The major histocompatibility complex-encoded class I-like HFE abrogates endocytosis of transferrin receptor by inducing receptor phosphorylation. Genes Immun. 2000;1:409–417. [PubMed]
46. Searle S, Bright N A, Roach T I, Atkinson P G, Barton C H, Meloen R H, Blackwell J M. Localization of Nramp1 in macrophages: modulation with activation and infection. J Cell Sci. 1998;111:2855–2866. [PubMed]
47. Sunder-Plassmann G, Patruta S I, Horl W H. Pathobiology of the role of iron in infection. Am J Kidney Dis. 1999;34(Suppl. 2):S25–S29. [PubMed]
48. Waheed A, Parkkila S, Zhou X Y, Tomatsu S, Tsuchihashi Z, Feder J N, Schatzman R C, Britton R S, Bacon B R, Sly W S. Hereditary emochromatosis: effects of C282Y and H63D mutations on association with beta2-microglobulin, intracellular processing, and cell surface expression of the HFE protein in COS-7 cells. Proc Natl Acad Sci USA. 1997;94:12384–12389. [PMC free article] [PubMed]
49. Waheed A, Parkkila S, Saarnio J, Fleming R E, Zhou X Y, Tomatsu S, Britton R S, Bacon B R, Sly W S. Association of HFE protein with transferrin receptor in crypt enterocytes of human duodenum. Proc Natl Acad Sci USA. 1999;96:1579–1584. [PMC free article] [PubMed]
50. Wang T, Lafuse W P, Zwilling B S. Regulation of toll-like receptor 2 expression by macrophages following Mycobacterium avium infection. J Immunol. 2000;165:6308–6313. [PubMed]
51. Wardrop S L, Richardson D R. The effect of intracellular iron concentration and nitrogen monoxide on Nramp2 expression and non-transferrin-bound iron uptake. Eur J Biochem. 1999;263:41–49. [PubMed]
52. Wardrop S L, Richardson D R. Interferon-gamma and lipopolysaccharide regulate the expression of Nramp2 and increase the uptake of iron from low relative molecular mass complexes by macrophages. Eur J Biochem. 2000;267:6586–6593. [PubMed]
53. Weiel J E, Adams D O, Hamilton T A. Biochemical models of gamma-interferon action: altered expression of transferrin receptors on murine peritoneal macrophages after treatment in vitro with PMA or A23187. J Immunol. 1985;134:293–298. [PubMed]
54. Weinberg E D. Patho-ecological implications of microbial acquisition of host iron. Rev Med Microbiol. 1998;9:171–178.
55. Weinberg E D. The role of iron in protozoan and fungal infectious diseases. J Eukaryot Microbiol. 1999;46:231–238. [PubMed]
56. Weinberg E D. Iron loading and disease surveillance. Emerg Infect Dis. 1999;5:346–352. [PMC free article] [PubMed]
57. Weinberg E D. Modulation of intramacrophage iron metabolism during microbial cell invasion. Microbes Infect. 2000;2:85–89. [PubMed]
58. Wessling-Resnick M. Biochemistry of iron uptake. Crit Rev Biochem Mol Biol. 1999;34:285–314. [PubMed]
59. Wood R J, Han O. Recently identified molecular aspects of intestinal iron absorption. J Nutr. 1998;128:1841–1844. [PubMed]
60. Zwilling B S, Kuhn D E, Wikoff L, Brown D, Lafuse W. Role of iron in Nramp1-mediated inhibition of mycobacterial growth. Infect Immun. 1999;67:1386–1392. [PMC free article] [PubMed]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)
PubReader format: click here to try

Formats:

Related citations in PubMed

See reviews...See all...

Cited by other articles in PMC

See all...

Links

Recent Activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...