Results: 5

1.
Figure 1

Figure 1. From: Purification and characterization of a human RNA adenosine deaminase for glutamate receptor B pre-mRNA editing.

Separation of two distinct adenosine deaminase activities from HeLa cell nuclear extracts. (A) Heparin affinity chromatography. (B) Q-Sepharose cation exchange chromatography. (C) Phenyl superose hydrophobic chromatography. The relative amount of editing activity in each fraction is indicated by the histogram at the bottom of the absorbency profile. Protein was monitored by absorbency at 280 nm (solid curves). Fractions were individually dialyzed before analyzing for GluR-B RNA editing (solid bar) and dsRNA deamination activities (open bar) by thin layer chromatography. Dashed lines indicate the salt gradient.

Jing-Hua Yang, et al. Proc Natl Acad Sci U S A. 1997 April 29;94(9):4354-4359.
2.
Figure 5

Figure 5. From: Purification and characterization of a human RNA adenosine deaminase for glutamate receptor B pre-mRNA editing.

The effect of mutations in the GluR-B Q/R and R/G site RNA on editing activity. (A) Editing activity of Q/R site mutations. (B) Editing activity of R/G site mutations. The potential secondary structure of the 58 nucleotide R/G site substrate and a similar 323 nucleotide Q/R site substrate are shown on the top of A and B. Two base mismatches at A13 and G20 of Q/R site, or A11 and G15 of the R/G site RNA were mutated to evaluate their importance for editing efficiency by rRED1. Editing efficiency was determined as in Fig. 3B. Mutations are denoted by the mismatched nucleotide and its position followed by its potential base paired nucleotide and its position. A13C309 and A11C47 are the wild-type substrates for Q/R and R/Q sites. In G13C309, nucleotide 13 of the Q/R site RNA is replaced by G. In A13U309, nucleotide 309 of Q/R site RNA is replaced by U. A13U309/G20C302 is a double mutation in which nucleotides 309 and 302 of the Q/R site RNA are replaced by U and C, respectively. The same nomenclature applies to the R/G site RNA mutations.

Jing-Hua Yang, et al. Proc Natl Acad Sci U S A. 1997 April 29;94(9):4354-4359.
3.
Figure 2

Figure 2. From: Purification and characterization of a human RNA adenosine deaminase for glutamate receptor B pre-mRNA editing.

Identification of the protein required for GluR-B RNA editing in HeLa cells. (A) Lane 1: UV crosslinking of phenyl superose column fractions. GluR-B RNA labeled at the editing site was used in UV crosslinking experiments to detect proteins in the phenyl superose column fractions that bind to GluR-B RNA. The proteins were resolved by SDS/PAGE, and a 90-kDa crosslinked protein is indicated. Lane 2: Silver-stained SDS/PAGE of the most active fractions. Lane 3: Western blot of the flow-through. Lane 4: Western blot of the most active fraction. Lane 5: Western blot of recombinant rRED1 protein containing one ≈5 kDa His-tag at its N terminus. Western blot analysis was performed with anti-rat RED1 polyclonal antibodies. (B) The most active fraction was resolved on a two-dimensional gel [first dimension: isoelectric focusing pH 3–10; second dimension: SDS/PAGE (10% gel)] and by Western blot analysis with anti-rat RED1 polyclonal antibodies as above.

Jing-Hua Yang, et al. Proc Natl Acad Sci U S A. 1997 April 29;94(9):4354-4359.
4.
Figure 4

Figure 4. From: Purification and characterization of a human RNA adenosine deaminase for glutamate receptor B pre-mRNA editing.

Editing of the minimal R/G substrate for rRED1. (A) RNA sequence and predicted structure surrounding the GluR-B R/G site. The minimal R/G site RNA consists of 19 nucleotides upstream of the R/G site (5′Up), 58 nucleotides of R/G site plus ECS sequence (Δ5′ + Δ3′) and 20 nucleotides downstream of the ECS sequence (3′Down). A dinucleotide (gg) was added to its 5′ end for efficient transcription. Arrow indicates the adenosine of the R/G editing site. (B) Editing activity was determined in the absence (−) or presence (+) of rRED1 for different lengths of R/G substrates. Q/R site RNA is used as a control (Q/R, lanes 1, 2). The minimal R/G site RNA (R/G, lanes 3 and 4) was made by RNA ligation of unlabeled 21 mer RNA (pppGGACCUAAAGGAUCCUCAUUA) and 5′ end-labeled 78 mer RNA lacking the 5′Up sequence (Δ5′Up). Deletion of 5′Up (Δ5′Up, lanes 5 and 6) and deletion of 5′Up and 3′Down (Δ5′ + Δ3′, lanes 7 and 8) were made by in vitro transcription based on PCR-generated templates. The adenosine at the editing site was added by ApG dinucleotide during transcription and labeled using T4 polynucleotide kinase.

Jing-Hua Yang, et al. Proc Natl Acad Sci U S A. 1997 April 29;94(9):4354-4359.
5.
Figure 3

Figure 3. From: Purification and characterization of a human RNA adenosine deaminase for glutamate receptor B pre-mRNA editing.

Editing kinetics of the ds adenosine deaminases. (A) GluR-B Q/R site RNA editing by recombinant hRED1. The kinetics of the deaminase reactions were studied under single turnover reaction conditions ([protein] ≫ [GluR-B RNA]). The reaction was sampled at 0, 1, 3, 5, 10, 20, 30, 45, 60, and 90 min (lanes 1–10, respectively). For comparison, a parallel experiment with recombinant rRED1 is also shown. (B) Substrate selectivity of the ds adenosine deaminases. GluR-B RNA editing and dsRNA deamination activities were compared under single turnover reaction conditions. Increasing amounts of purified HeLa cell GluR-B activity (panel 1), recombinant hRED1 protein (panel 2), recombinant rRED1 protein (panel 3) and recombinant dsRAD protein (panel 4) were added to the reaction. The percentage of edited RNA was determined by thin layer chromatography and quantitated by the Fuji imaging system.

Jing-Hua Yang, et al. Proc Natl Acad Sci U S A. 1997 April 29;94(9):4354-4359.

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk