We are sorry, but NCBI web applications do not support your browser and may not function properly. More information

Results: 5

1.
Figure 2

Figure 2. PCR analysis of plasmid integration.. From: Stably Luminescent Staphylococcus aureus Clinical Strains for Use in Bioluminescent Imaging.

Primers specific for pRP1195 and chromosomal sequences were used in PCR reactions with chromosomal DNA from SAP231 (integrant) and NRS384 (WT) as templates. Primers used were: C1, (GCATGCCATTTTCTTTATCATAAGTG); C2, (CAGTTATGGTGGTCTTATAGAGAGAC); P1, (CAGTCAGAGGAGCGCCGACAACACC); P2, (TTTCGTTTGTTGAACTAATGGGTGC). Molecular weight in kilobases is indicated on the left.

Roger D. Plaut, et al. PLoS One. 2013;8(3):e59232.
2.
Figure 1

Figure 1. Map of integrative plasmid pRP1195.. From: Stably Luminescent Staphylococcus aureus Clinical Strains for Use in Bioluminescent Imaging.

Features added to the pMAD backbone as described in Materials and Methods include: cm, chloramphenicol resistance gene; homology, PCR fragment in the area of pseudogene USA300_HOU1102 amplified from NRS384; LuxB, A, D, C, and E, modified lux operon from Photorhabdus luminescens.

Roger D. Plaut, et al. PLoS One. 2013;8(3):e59232.
3.
Figure 4

Figure 4. BALB/c intravenous infection with wild-type or luminescent NRS384.. From: Stably Luminescent Staphylococcus aureus Clinical Strains for Use in Bioluminescent Imaging.

In an intravenous model, mice were injected via the tail vein with either the wild-type USA300 strain (NRS384) or the luminescent strain (SAP149). Mice injected with the luminescent strain were imaged over the course of 6d (A); images are representative. There was no statistically significant difference in survival of mice injected with the two strains (B) by either the log-rank (Mantel-Cox) Test (P = 0.46) or the Gehan-Breslow-Wilcoxon Test (P = 0.68); n = 20 mice per group.

Roger D. Plaut, et al. PLoS One. 2013;8(3):e59232.
4.
Figure 3

Figure 3. Analysis of in vitro growth.. From: Stably Luminescent Staphylococcus aureus Clinical Strains for Use in Bioluminescent Imaging.

A) In vitro growth curves. Strains were grown overnight in TSB with (luminescent strains) or without (parental strains) 10 µg/ml chloramphenicol and subcultured at a dilution of 1∶100 in TSB without antibiotic. MW2-Lux, SAP227; Newman-Lux, SAP229; NRS384-Lux, SAP231. B) Luminescence after in vitro outgrowth. SAP231 was grown in TSB and subcultured three times over the course of 48 h. Serial dilutions were plated on TSA in the absence of antibiotics, and plates were imaged as described in Materials and Methods.

Roger D. Plaut, et al. PLoS One. 2013;8(3):e59232.
5.
Figure 5

Figure 5. BALB/c skin and soft tissue infection with wild-type or luminescent NRS384.. From: Stably Luminescent Staphylococcus aureus Clinical Strains for Use in Bioluminescent Imaging.

In a skin and soft tissue model (SSTI), mice were inoculated in the left ear with NRS384 or SAP149. Mice inoculated with SAP149 were imaged over the course of several days (A); images are representative. On days 1, 4, and 7 post infection, mice were euthanized and ear pinna homogenates were serially diluted and plated (B). There was no statistically significant difference in CFU recovered per ml of homogenate between mice infected with each strain (two-tailed t-test; P = 0.55; bars represent 95% confidence interval; n = 8 mice per group).

Roger D. Plaut, et al. PLoS One. 2013;8(3):e59232.

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk