Display Settings:

Items per page

Results: 8

1.
Figure 5

Figure 5. Hepatocellular neoplasms in Tg05 wildtype HBV transgenic mice.. From: Transgenic Expression of Entire Hepatitis B Virus in Mice Induces Hepatocarcinogenesis Independent of Chronic Liver Injury.

(A) In situ view of a Tg05 liver with tumor nodules (arrows). (B) Hematoxylin and eosin stained section of a normal liver in 24-month old Tg05 mouse, showing the lack of inflammation. (C) Hematoxylin and eosin stained section of a liver tumor, showing a hepatocellular adenoma (arrows) with mild atypia and compression of surrounding liver parenchyma. (D) Hematoxylin and eosin stained section of a liver tumor, showing a HCC with trabecular pattern.

Bing Na, et al. PLoS One. 2011;6(10):e26240.
2.
Figure 4

Figure 4. Increase in incidence of hepatocellular tumors in the Mutant 1 and wildtype HBV transgenic mice.. From: Transgenic Expression of Entire Hepatitis B Virus in Mice Induces Hepatocarcinogenesis Independent of Chronic Liver Injury.

Incidence of all hepatocellular tumors (All) and HCC, shown as a percentage of mice with tumor, is from 33 non-transgenic, 19 Mutant 1-Line 4, 30 Mutant 1-Line 7, and 20 Tg05 wildtype HBV male mice. The non-transgenic mice are the littermates of Mutant 1-Line 4, Line 7, or Tg05 mice and because they have comparable tumor incidence, they are grouped together here. Significant differences between the transgenic and non-transgenic mice are indicated by one (P<0.05) or two (P<0.01) asterisks.

Bing Na, et al. PLoS One. 2011;6(10):e26240.
3.
Figure 3

Figure 3. Hepatocellular neoplasms in Mutant 1 mice.. From: Transgenic Expression of Entire Hepatitis B Virus in Mice Induces Hepatocarcinogenesis Independent of Chronic Liver Injury.

(A) In situ view of a Mutant 1 liver with tumor nodules (arrows). Note the increased vascularity. (B) Hematoxylin and eosin stained section of a liver tumor, showing a hepatocellular adenoma (arrows) with mild atypia and compression of surrounding liver parenchyma. (C) Hematoxylin and eosin stained section of a liver tumor, showing a HCC with trabecular pattern. (D) Immunohistochemical staining for surface protein of a hepatocellular adenoma (arrows) in the liver of a 24-month old Mutant 1 mouse, showing persistent accumulation of surface proteins in the neoplastic cells.

Bing Na, et al. PLoS One. 2011;6(10):e26240.
4.
Figure 8

Figure 8. Oncogenic mutation of β-catenin in HCC of Mutant 1 transgenic mice.. From: Transgenic Expression of Entire Hepatitis B Virus in Mice Induces Hepatocarcinogenesis Independent of Chronic Liver Injury.

(A) Immunoblot analysis of β-catenin in HCC and associated non-tumor (NT) liver tissues from 3 Mutant 1 trangsgenic mice. One truncated β-catenin was detected in HCC of mouse 2. (B) Detection by RT-PCR of the deletion site in the truncated β-catenin shown in (A). The truncated DNA fragments are indicated by asterisks. F1 to F5, forward primers 1 to 5; R1 to R5, reverse primers 1 to 5 [44]. (C) Detection by DNA sequencing of T41I, a point mutation in one of the four GSK-3β phosphorylation sites, in HCC from another Mutant 1 transgenic mouse.

Bing Na, et al. PLoS One. 2011;6(10):e26240.
5.
Figure 2

Figure 2. Characterization of younger Mutant 1 mice.. From: Transgenic Expression of Entire Hepatitis B Virus in Mice Induces Hepatocarcinogenesis Independent of Chronic Liver Injury.

(A) Low-power view of liver from 6-month old Mutant 1 mouse stained for HBV surface protein, showing positive cells in a zonal pattern in the liver. (B) High-power view of Mutant 1 liver stained for HBV surface protein, showing strong staining at the periphery of the hepatocyte cytoplasm, identical to the staining pattern of human hepatocytes infected with preS2 mutants [19]. (C) Liver of 6-month old Tg05 wildtype HBV mice stained for HBV surface protein. (D) Liver of non-transgenic mice as a negative control in immunohistochemistry of HBV surface protein. (E) Electron micrograph of a Mutant 1 hepatocyte, showing the presence of long surface protein filaments within the ER (arrow, longitudinal sections; chevron, cross sections). (F) Hematoxylin and eosin stained section of 4-month old Mutant 1 liver, showing the lack of inflammation. (G) Serum AST levels (mean ± SEM) in Mutant 1 mice (12-23 mice for each time point) and non-transgenic littermates (6–11 mice for each time point), showing no significant difference during the first 17 months of age.

Bing Na, et al. PLoS One. 2011;6(10):e26240.
6.
Figure 6

Figure 6. Distinct integration sites of HBV in the mutant 1 and wildtype HBV transgenic mice.. From: Transgenic Expression of Entire Hepatitis B Virus in Mice Induces Hepatocarcinogenesis Independent of Chronic Liver Injury.

The HBV integration sites are identified for Mutant 1-Line 7 (A–C), Mutant 1-Line 4 (D–F), and wildtype Tg05 (G-I) mice. (A, D, and G) Detection of an end of the HBV transgene and its flanking mouse sequence by PCR. Lane 1, 1 kb Plus DNA size ladder (Fermentas); lane 2, PCR product. (B, E, and H) Analysis of the integration sites by fluorescent in situ hybridization (FISH). The metaphase cell was stained with an HBV probe (red arrow) and with DAPI (blue). The cell in (B) was also stained with a probe (green arrow) derived from the mouse BAC clone RP23-355K3 that corresponds to band E1 of chromosome 11 (11E1). (C, F, and I) Cytogenetic localization of the HBV transgenes. Shown from left to right are the mouse chromosome ideograms, the corresponding G-banded chromosomes, and the DAPI-banded chromosomes with HBV signal from the FISH figures. RP23-355K3 was hybridized to 11qE1 and cross-hybridized to chromosome 6 at band B1. The integrated HBV gene (red arrow) was localized to chromosome 11E1 in Mutant 1-Line 7, to chromosome 1F in Mutant 1-Line 4, and to chromosome 11B5 in wildtype Tg05 mice.

Bing Na, et al. PLoS One. 2011;6(10):e26240.
7.
Figure 7

Figure 7. Increase in unfolded protein response (UPR) and cyclin D1 expression in Mutant 1 mice.. From: Transgenic Expression of Entire Hepatitis B Virus in Mice Induces Hepatocarcinogenesis Independent of Chronic Liver Injury.

(A) RT-PCR detection of XBP1 mRNA in liver of male Mutant 1, non-transgenic, and wildtype HBV transgenic mice at 4 months of age, using primers that bracket the intron spliced out following UPR activation [47]. The first lane is a positive control from a non-transgenic mouse at 24 hours after injection with 1 mg/kg of tunicamycin. (B) Activation of cyclin D1 promoter by XBP1(S) in human hepatoma C3A cells. Reporter constructs with firefly luciferase under the control of either wildtype cyclin D1 (CD1) promoter or a mutant cyclin D1 (mCD1) promoter were cotransfected into C3A cells with the XBP1(S)-expressing pXBP1(S) plasmid [48] or the pCDNA3 vector [49]. The firefly luciferase activity was normalized to Renilla luciferase activity from a cytomegalovirus promoter-Renilla luciferase plasmid cotransfected into the cells. The data (mean ± SE) are from a representative experiment with triplicates. (CE) Immunohistochemical staining for cyclin D1 in liver of half-year-old Mutant 1 (C), non-transgenic (D), and wildtype HBV transgenic (E) mice.

Bing Na, et al. PLoS One. 2011;6(10):e26240.
8.
Figure 1

Figure 1. Expression and replication of Mutant 1 HBV in transgenic mice.. From: Transgenic Expression of Entire Hepatitis B Virus in Mice Induces Hepatocarcinogenesis Independent of Chronic Liver Injury.

(A) Map of the HBV surface gene, with the 3 initiation codons for the 3 forms of surface protein indicated by asterisks. Also shown are PreS1, S, and X RNA transcripts from HBV. Mutant 1 contains a missense mutation of the preS2 start codon and a 54-bp deletion (marked as Δ2) corresponding to codons 4 through 21 in the preS2 region. (B) Primer extension analysis [28] of the preS1 and S transcripts in the liver of Mutant 1 mice, compared to Tg05 wildtype HBV mice. Note that the S transcript products are smaller in the Mutant 1 mice, because of the deletion between the primer and the mRNA start sites [28], and the pattern of start sites is also different from that in wildtype HBV mice, since the deletion extends slightly into the initiation region of the S transcripts[19]. (C) Western blotting of the large and small surface proteins in the liver of Mutant 1 and wildtype HBV mice. LS and SS, large and small surface protein respectively. Each protein has 2 forms, differing in the glycosylation. Note that the large surface protein is smaller in the Mutant 1 mice, because of the deletion in the preS2 region. In the top part, the samples were separated on a 10% polyacrylamide gel, while in the bottom part, the samples were separated on a 12% gel. (D) PCR detection of circulating HBV [13] in the serum of Mutant 1 mice (lanes 1 and 4), compared to wildtype HBV mice (lanes 3 and 5). For lanes 1-3, the primers (5′ATATTGCCTCTCACATCTCGTCAATCTC and 5′AGCGGTATAAAGGGACTCACGATGCTGT) bracketed nucleotides 101 to 800 in the surface gene, downstream of the deletion. For lanes 4–5, the primers bracketed the deletion in the preS2 region [21]. (E) HBV titers in Mutant 1 and wildtype HBV transgenic mice. The amount of HBV genomic DNA in serum of mice at 2-3 months of age is determined by qPCR. The viral titer in wildtype HBV transgenic mice (Tg05) is significantly higher than that in both Mutant 1 Line 4 and Line 7 mice (P<0.02).

Bing Na, et al. PLoS One. 2011;6(10):e26240.

Display Settings:

Items per page

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk