Display Settings:

Items per page

Results: 6

1.
Figure 4

Figure 4. From: Widespread expression of the Supv3L1 mitochondrial RNA helicase in the mouse.

The EGFP reporter expression in postimplantation embryos. (A) Supv3L1tm6Jkl/+ embryo at E7.5 (+/−) and wild-type embryo (wt) photographed in the bright field. (B) EGFP emission of the same embryos shown in (A). (C) Merged images of (A) and (B). (D) EGFP expression in wild-type (wt) and Supv3L1tm6Jkl/+ (+/−) embryos at E9.5. (E) Fluorescent light emission in wild-type (wt) and Supv3L1tm6Jkl/+ (+/−) embryos at E11.5. (F) Wild-type (wt) and Supv3L1tm6Jkl/+ (+/−) embryos showing EGFP expression at E13.5. Note rather weak signal in the area of the developing liver. (G) The EGFP reporter expression at E16.5. (H) The EGFP reporter expression at birth. (I) Yolk sac from Supv3L1tm6Jkl/+ (+/−) and wild-type embryos at E16.5.

Erin Paul, et al. Transgenic Res. ;19(4):691-701.
2.
Figure 5

Figure 5. From: Widespread expression of the Supv3L1 mitochondrial RNA helicase in the mouse.

(A) Expression of EGFP reporter in tissue dissected out from 10 weeks old wild-type (wt) and Supv3L1tm6Jkl/+ (+/−) male. Images were taken at the same conditions of magnification, brightness, gain and exposure time, to reflect relative intensities of the fluorescence light emission in different tissues. Note remarkably higher reporter expression in the brain, testes, eyes, muscle and the thymus. (B) Relative expression levels of EGFP reporter in tissue dissected out from 10 weeks old targeted (Supv3L1tm6Jkl/+) and heterozygous transgenic (Tg(EGFP/Supv3L1)-1) animals.

Erin Paul, et al. Transgenic Res. ;19(4):691-701.
3.
Figure 2

Figure 2. From: Widespread expression of the Supv3L1 mitochondrial RNA helicase in the mouse.

Expression levels of Supv3L1 and EGFP reporter as assayed by Western blotting. (A) Tissue extracts were prepared from 10 weeks old wild-type mouse and analyzed using rabbit antibody against mouse Supv3L1. (B) Quantification of the data shown in (A) after correcting for loading variations using GAPDH as an internal standard. The results represent an average of three gels and are plotted in arbitrary units/mg of the protein extract. (C) Western blotting performed using tissue extracts obtained from 10 weeks old targeted (Supv3L1tm6Jkl/+) animal and rabbit antibodies against EGFP. (D) Quantification of the data shown in (C) representing an average of three gels.

Erin Paul, et al. Transgenic Res. ;19(4):691-701.
4.
Figure 3

Figure 3. From: Widespread expression of the Supv3L1 mitochondrial RNA helicase in the mouse.

The EGFP reporter expression at preimplantation stages. (A, A’) One-cell embryos derived from matings of Supv3L1tm6Jkl/+ males and wild type females (paternal transmission of the reporter allele). Note no detectable expression of the EGFP transgene. (B, B’) Two-cell embryos derived from matings of Supv3L1tm6Jkl/+ males and wild type females. Note no EGFP expression. (C, C’) Blastocysts derived from matings of Supv3L1tm6Jkl/+ males and wild type females. Rectangles indicate examples of wild-type blastocysts negative for EGFP expression. (D, D’) One-cell embryos obtained from Supv3L1tm6Jkl/+ females mated with wild-type males (maternally transmitted reporter). Note that all embryos are EGFP positive while only half of them can be EGFP-transgene positive. (E, E’) Two-cell embryos derived from Supv3L1tm6Jkl/+ females mated with wild-type males. Note that all E1.5 embryos are EGFP positive while only half of them are positive for the transgene. (F, F’) Blastocysts isolated from Supv3L1tm6Jkl/+ females after mating with wild-type males (maternally transmitted reporter). Roughly 50% of these balstocysts are EGFP positive and 50% are negative. One of each kind is shown.

Erin Paul, et al. Transgenic Res. ;19(4):691-701.
5.
Fig. 6

Fig. 6. From: Widespread expression of the Supv3L1 mitochondrial RNA helicase in the mouse.

Detecting EGFP emission in tissue sections. (A) H&E stained section of the skin derived from Supv3L1tm6Jkl/+ animal. (B) Fluorescent light emission from the same section before H&E staining. Note that all cell layers including subcutaneous muscle fibers are positive. Bright fluorescent spots on the epidermal side of the skin are the hair shafts. (C) H&E stained section of the wild-type skin. Ad, adipose layer; Der, dermis; Ed, epidermis; Mf, subcutaneous muscle fibers. (D) Same section before H&E staining that shows no EGFP emission. Bright spots on the epidermal side of the crossection are the hair shafts that fluorize in the EGFP-independent manner. (E) Fluorescent light emission in mouse retina cryosections and (F) co-staining with hoechst (blue; nuclear stain). The signal is predominantly detected in photoreceptor inner segment (IS) and outer plexiform layer (OPL). OS: outer segment; INL: inner nuclear layer; IPL: inner plexiform layer; GCL: ganglion cell layer.

Erin Paul, et al. Transgenic Res. ;19(4):691-701.
6.
Figure 1

Figure 1. From: Widespread expression of the Supv3L1 mitochondrial RNA helicase in the mouse.

Generating the knock-in EGFP allele (Supv3L1tm6Jkl). (A) Genomic structure of the wild-type Supv3L1 locus, targeting vector, and allelic modification generated in this study. Regions of homology between the genomic sequence and the vector are shown in bold. XmaI, XmaI restriction site; SpeI, SpeI restriction site; Pr, probe used in Southern blotting; EGFP, enhanced green fluorescent protein coding sequence; SV40 polyA, SV40 polyadenylation signals; PSV40, SV40 promoter; Kanr/Neor, neomycin/kanamycin resistance gene of Tn5; HSV TK polyA, polyadenylation signals from the Herpes simplex virus thymidine kinase (HSV TK) gene. Black boxes represent the first three exons of Supv3L1 (composed of total 16 exons). Arrows indicate the direction of transcription. Arrowheads designate the positions of PCR primers. (B) Southern hybridization analysis of targeted ES cells showing a correct integration event at the 5’ arm. Probe was generated by PCR using genomic DNA and primer pair c + d (ATGTCCGCACGCTGCGACTGTCGTCAGCC and GGCTGACGACAGTCGCAGCGTGCGGACAT). (C) PCR analysis of a targeted ES cell clone using primers a+b (CACGGCACTGCGTGCTTGGCAAGGCATAT and GACAGAATAAAACGCACGGTGTTGGGTCGT) confirming correct integration event at the 3’ arm.

Erin Paul, et al. Transgenic Res. ;19(4):691-701.

Display Settings:

Items per page

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk