Display Settings:

Items per page
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information

Results: 8

1.
Figure 7

Figure 7. From: Contributions of Specificity Protein-1 and Steroidogenic Factor 1 to Adcy4 Expression in Y1 Mouse Adrenal Cells.

Effect of an epitope-tagged SF1 on Adcy4 promoter activity in Y1 cells. Y1 cells were transfected with the luciferase reporter plasmids p-970Adcy4Luc (black bars) and p-18Adcy4Luc (white bars) together with equimolar amounts of a His-tagged SF1 expression vector (SF1+), a His-tagged SF1 antisense control (SF1) or the empty expression plasmid, pcDNA3.1. The luciferase reporter gene constructs and the methods of data analysis are as indicated in Fig. 2. The activity of His-tagged SF1 was compiled from six independent experiments, whereas the activities of the two control plasmids were each compiled from three independent experiments. The activities of p-18Adcy4Luc were significantly different from those of p-970Adcy4Luc (P < 0.001) under all experimental conditions. The effect of His-tagged SF1 on p-970Adcy4Luc (a) was significantly different (P < 0.001) from that of pcDNA3.1 or the antisense His-tagged SF1.

Xianliang Rui, et al. Endocrinology. 2008 July;149(7):3668-3678.
2.
Figure 3

Figure 3. From: Contributions of Specificity Protein-1 and Steroidogenic Factor 1 to Adcy4 Expression in Y1 Mouse Adrenal Cells.

Effects of internal deletions on Adcy4 promoter activity in Y1 and mutant 10r-6 cells. The activities of p-404Adcy4Luc and p-18Adcy4Luc were compared with the activities of p-404Adcy4Luc constructs containing either an internal deletion between −135 and −19 (Δ −135/−19) or a deletion of intron I (Δ intron I) after transfection into Y1 (black bars) and mutant 10r-6 cells (white bars) as described in Fig. 2. Results were compiled from three to six independent experiments, depending on the plasmid and cell line and are expressed as means ± sem. Note that the activities obtained using the Δ intron I construct are represented on a different scale. Bars (a), values significantly different from p-18Adcy4Luc, P < 0.001; bars (b), values significantly different from p-404Adcy4Luc, P < 0.001. Only p-404Adcy4Luc, and the Δ intron I construct had activities that were significantly different in parent Y1 cells and mutant 10r-6 cells, P < 0.001 (a and b).

Xianliang Rui, et al. Endocrinology. 2008 July;149(7):3668-3678.
3.
Figure 6

Figure 6. From: Contributions of Specificity Protein-1 and Steroidogenic Factor 1 to Adcy4 Expression in Y1 Mouse Adrenal Cells.

Contributions of the Sp1 and SF1 binding sites to Adcy4 promoter activity. Y1 (black bars) and mutant 10r-6 (white bars) cells were transfected with luciferase expression vectors (0.41 pmol/dish) driven by exon I of Adcy4 plus 142 bp of 5′flanking DNA (p-142/+92) or p-142/+92 constructs with mutations in the Sp1A (Sp1A), Sp1B (Sp1B), and/or SF1 (SF1) sites as indicated. The activities of these constructs were compared with that of a truncated promoter extending only18 bp upstream of the Adcy4 transcription start site (p-18/+92). Results compiled from three independent experiments are expressed as described in the legend to Fig. 2. Bars (a and b), values that are significantly different in Y1 and mutant 10r-6 cells at P < 0.001 and < 0.05, respectively; bars (c), values obtained in Y1 cells that are significantly different from the value obtained using the wild-type −142/+92 construct. Bars (*), significant differences in activities in Y1 cells between the indicated plasmids (P < 0.001).

Xianliang Rui, et al. Endocrinology. 2008 July;149(7):3668-3678.
4.
Figure 5

Figure 5. From: Contributions of Specificity Protein-1 and Steroidogenic Factor 1 to Adcy4 Expression in Y1 Mouse Adrenal Cells.

Interaction of SF1 with the proximal promoter region of Adcy4 in situ. Cross-linked nuclear extracts of Y1 cells expressing a myc- and hemagglutinin-tagged SF1 were sonicated, immunoprecipitated, and assayed for Adcy4 DNA by PCR as described in Materials and Methods. Where indicated, samples were immunoprecipitated with an SF1 antibody (anti-SF1; Upstate BioTechnology), a hemagglutinin epitope antibody (anti-HA; Santa Cruz Biotechnology Inc., Santa Cruz, CA), or a control IgG. A sample containing 1% of the sonicated DNA used for immunoprecipitation (input DNA) was included as a positive control for Adcy4. Immunoprecipitated DNA was amplified using primer pairs that spanned the proximal promoter region of Adcy4 from −199 to +4 (A) or primer pairs that spanned a region from +2548 to +2744 downstream of the transcription start site and within intron 4 of Adcy4 (B). Amplified fragments were sized using a 100-bp DNA ladder (Fermentas Canada, Burlington, Ontario, Canada).

Xianliang Rui, et al. Endocrinology. 2008 July;149(7):3668-3678.
5.
Figure 4

Figure 4. From: Contributions of Specificity Protein-1 and Steroidogenic Factor 1 to Adcy4 Expression in Y1 Mouse Adrenal Cells.

Sp1 and SF1 binding sites in the proximal promoter region of Adcy4. A, DNA-protein interactions were assessed using radiolabeleld double-stranded oligonucleotides that included the Sp1A site (1), the Sp1A site mutated (2), the overlapping Sp1B/SF1 sites (3), and the Sp1B and SF1 sites mutated (4 and 5, respectively). These radiolabeled oligonucleotides were evaluated for interaction with BSA or with nuclear extracts (NE) from Y1 adrenal cells by EMSA. Where indicated, binding reactions were carried out in the presence of a 100-fold molar excess of the corresponding unlabeled oligonucleotides, or bona fide Sp1 (ATTCGATCGGGGCGGGGCGAGC) and SF1 (CTTTACTCAAGGTGAGGATAAA)binding sites. The positions of specific shifted complexes (arrows) are indicated. B, Complex formation was determined as in panel A using double-stranded oligonucleotide probes containing the Sp1A site (1) or the overlapping Sp1B/SF1 sites (2). Where indicated, the corresponding unlabeled oligonucleotides (100-fold molar excess), a rabbit IgG control, IgG antibodies against Sp1 or Sp3 (1 μg), or SF1 antiserum (1 μl) were added to the reaction. The positions of the complexes displaced by the Sp1, Sp3, and SF1 antibodies are indicated. C, DNA-protein interactions on the overlapping Sp1B/SF1 site were assessed using nuclear extracts from either Y1 or 10r6 cells or BSA as indicated. Reactions carried out in the presence of 100-fold molar excess of the unlabeled SP1B/SF1 oligonucleotide were included as controls for specificity. The identities of the shifted complexes are based on their displacement with specific antibodies (B).

Xianliang Rui, et al. Endocrinology. 2008 July;149(7):3668-3678.
6.
Figure 8

Figure 8. From: Contributions of Specificity Protein-1 and Steroidogenic Factor 1 to Adcy4 Expression in Y1 Mouse Adrenal Cells.

Effects of SF1 knockdown on Adcy4 mRNA levels. Mutant 10r-6 and parent Y1 cells were transfected with siRNAs targeted to specific regions of the SF1 transcript. Stable transformants were recovered and transcripts were assayed by quantitative RT-PCR. Where indicated, SF1 cDNA was amplified using TGGACTATTCGTACGACGAGG and GACTGTGCGCTTGAAGAAGC; Adcy4 cDNA was amplified using TGAGGAGGAAGACGAGAAGG and TGTCAAGGTGGCTTAGGTGG; Mc2r transcripts were amplified using CAGTGCTCACCTTCACATCG and AAGGATGGTTAGTGTCATGGC as forward and reverse primers, respectively. Results are expressed as the mean percentage of transcript levels obtained in untransfected cells ± sem. A, Mutant 10r-6 cells were transfected with siRNAs targeted to nucleotides 151/171 (SF1 siRNA no. 1), 565/585 (SF1 siRNA no. 2), and 1375/1395 (SF1 siRNA no. 3) of SF1 and results were compiled from three separate experiments with each transformant. Cells transfected with siRNA targeted to the nuclear receptor, germ cell nuclear factor (GCNF) (Nr6a1) served as a negative control. The levels of SF1 (black bars) and Adcy4 (white bars) observed in 10r-6 cells expressing SF1 siRNA were all significantly different from the corresponding levels obtained in 10r-6 cells expressing GCNF siRNA (determined by ANOVA followed by the Newman-Keuls multiple comparison test). B, Y1 cells were transfected with SF1 siRNA no. 1, and results were compiled from four independently isolated SF1 siRNA expressing clones. The levels of SF1, Mc2r, and Adcy4 observed in cells expressing SF1 siRNA (black bars) were all significantly different from the levels obtained in control samples (white bars) as determined by ANOVA followed by the Bonferroni multiple comparison test after log transformation of the data to reduce sample variances (53).

Xianliang Rui, et al. Endocrinology. 2008 July;149(7):3668-3678.
7.
Figure 2

Figure 2. From: Contributions of Specificity Protein-1 and Steroidogenic Factor 1 to Adcy4 Expression in Y1 Mouse Adrenal Cells.

Effects of 5′ deletions on Adcy4 promoter activity in Y1 and mutant 10r-6 cells. Y1 (black bars) and mutant 10r-6 cells (white bars) were transfected with luciferase expression vectors (0.41 pmol/dish) containing exon I, intron I, and part of exon II up to the initiator ATG and varying lengths of DNA flanking the transcription start site (arrow). The last exon of the Ripk3 gene is indicated, as is the sequence between −135 and −19 that is conserved among species (boxed). The restriction sites used to progressively truncate the 5′ end of the Adcy4 promoter also are shown; the sites destroyed by blunt end ligation are indicated with brackets. Results are expressed as mean percentages of the activity obtained with the pGL3 control vector (i.e. a luciferase reporter gene under control of the Simian virus 40 core promoter and enhancer) ± sem. Depending on the plasmid, data were compiled from eight to 20 independent experiments in Y1 cells and from four to 11 independent experiments for 10r-6 cells. Statistically significant differences, determined by ANOVA followed by the Newman-Keuls multiple comparison test, are: a, different from p-18Adcy4Luc, P < 0.001; b, different from p-1459Adcy4Luc, P < 0.001. All of the constructs, except p-336Adcy4Luc and p-18Adcy4Luc, had activities that were significantly higher (P < 0.05) in parent Y1 cells than in mutant 10r-6 cells.

Xianliang Rui, et al. Endocrinology. 2008 July;149(7):3668-3678.
8.
Figure 1

Figure 1. From: Contributions of Specificity Protein-1 and Steroidogenic Factor 1 to Adcy4 Expression in Y1 Mouse Adrenal Cells.

The proximal promoter region of Adcy4. A, The 5′ ends of Adcy4 transcripts were determined by primer extension using total and poly(A)-enriched RNA from Y1 cells and from mouse liver. The sizes of the extended fragments were determined by sequencing the complementary strand of an Adcy4 cDNA clone (accession no. AF442771) using the same primer. The sequences in capital letters are derived from the Adcy4 cDNA, the sequences in small letters are derived from the vector; the relative positions of the major (arrow) and minor (asterisks) transcripts on the sequencing ladder are indicated. B, The 5′ ends of the Adcy4 transcripts from Y1 cells and mouse liver were compared with those of several full-length RIKEN cDNA clones obtained from various origins. These ends were mapped to a region of the Adcy4 genomic clone (accession no. AC098877). The 5′-end of the major transcript identified in Y1 adrenal cells and C57BL/6 mouse liver is arbitrarily designated +1. Minor transcripts are denoted with asterisks. This region contains three putative Sp1 binding sites (underlined and labeled Sp1A, Sp1B and Sp1C) and a putative SF1 binding site that partially overlaps the Sp1B site (boxed) as identified by searching the Transfac Professional database (51) with the PATCH algorithm (formerly Patsearch) (52). C, The proximal 144 bp of DNA sequence flanking the mouse Adcy4 was compared with corresponding sequences flanking the Adcy4 from rat (accession no. NT_039606), human (accession no. NT_026437), chimpanzee (accession no. NW_001224596), rhesus monkey (accession no. NW_0011211199), and dog (accession no. NW_8876327). The sequences were aligned using a ClustalW alignment tool provided with MacVector 7.2 software (MacVector, Inc., Cary, NC); conserved sequences (boxed) and gaps introduced for optimal alignment (−) are indicated. Part of the sequence assigned to exon I of the rhesus monkey Adcy4 (underlined) is included to complete the comparison.

Xianliang Rui, et al. Endocrinology. 2008 July;149(7):3668-3678.

Display Settings:

Items per page

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk