Alternative titles; symbols
Other entities represented in this entry:
HGNC Approved Gene Symbol: MIR3120
Cytogenetic location: 1q24.3 Genomic coordinates (GRCh38): 1:172,138,808-172,138,888 (from NCBI)
MicroRNAs (miRNAs) are small noncoding RNAs that bind to complementary sequences in the 3-prime UTRs of target mRNAs and inhibit protein translation. The MIR3120 precursor stem-loop sequence encodes 2 mature miRNAs, MIR3120-5p and MIR3120-3p, from its 5-prime and 3-prime ends, respectively (Scott et al., 2012).
Scott et al. (2012) cloned rat Mir3120, and by database analysis they identified human MIR3120. Northern blot analysis detected Mir3120 expression in day-12.5 mouse embryos. PCR analysis of cultured rat hippocampal neurons detected coexpression of Mir3120, its host gene Dnm3 (611445), and Mir214 (610721), which overlaps Mir3120 and Dnm3 on the opposite strand.
Scott et al. (2012) found that the 3-prime UTR of rat and human HSC70 (HSPA8; 600816) contains recognition sequences for both MIR3120-5p and MIR3120-3p. Overexpression of rat Mir3120 or a vector containing repeats of the MIR3120 recognition sequence reduced expression of Hsc70 and a human HSC70 reporter gene in rat neuronal cells. Mir3120 also reduced expression of the HSC70 cochaperone auxilin (DNAJC6; 608375), another predicted MIR3120 target. Mir3120 reduced the surface content of clathrin-coated particles in hippocampal and cortical neurons. Scott et al. (2012) concluded that both MIR3120 and its host gene, DNM3, are involved in synaptic vesicle recycling.
Hartz (2012) mapped the MIR3120 gene to chromosome 1q24.3 based on an alignment of the mature MIR3120-5p sequence (CCUGUCUGUGCCUGCUGUACA) with the genomic sequence (GRCh37).
Scott et al. (2012) found that rat and human MIR3120 map to intron 13 of the DNM3 gene in the sense orientation. The MIR214 gene overlaps the MIR3120 gene in the antisense orientation in rat and human.
Hartz, P. A. Personal Communication. Baltimore, Md. 7/2/2012.
Scott, H., Howarth, J., Lee, Y. B., Wong, L.-F., Bantounas, I., Phylactou, L., Verkade, P., Uney, J. B. MiR-3120 is a mirror microRNA that targets heat shock cognate protein 70 and auxilin messenger RNAs and regulates clathrin vesicle uncoating. J. Biol. Chem. 287: 14726-14733, 2012. [PubMed: 22393045] [Full Text: https://doi.org/10.1074/jbc.M111.326041]