Entry - *614722 - MICRO RNA 3120; MIR3120 - OMIM

 
 
* 614722

MICRO RNA 3120; MIR3120


Alternative titles; symbols

miRNA3120
MIR3120-5p


Other entities represented in this entry:

MICRO RNA 3120-3p, INCLUDED; MIR3120-3p, INCLUDED

HGNC Approved Gene Symbol: MIR3120

Cytogenetic location: 1q24.3     Genomic coordinates (GRCh38): 1:172,138,808-172,138,888 (from NCBI)


TEXT

▼ Description

MicroRNAs (miRNAs) are small noncoding RNAs that bind to complementary sequences in the 3-prime UTRs of target mRNAs and inhibit protein translation. The MIR3120 precursor stem-loop sequence encodes 2 mature miRNAs, MIR3120-5p and MIR3120-3p, from its 5-prime and 3-prime ends, respectively (Scott et al., 2012).


▼ Cloning and Expression

Scott et al. (2012) cloned rat Mir3120, and by database analysis they identified human MIR3120. Northern blot analysis detected Mir3120 expression in day-12.5 mouse embryos. PCR analysis of cultured rat hippocampal neurons detected coexpression of Mir3120, its host gene Dnm3 (611445), and Mir214 (610721), which overlaps Mir3120 and Dnm3 on the opposite strand.


▼ Gene Function

Scott et al. (2012) found that the 3-prime UTR of rat and human HSC70 (HSPA8; 600816) contains recognition sequences for both MIR3120-5p and MIR3120-3p. Overexpression of rat Mir3120 or a vector containing repeats of the MIR3120 recognition sequence reduced expression of Hsc70 and a human HSC70 reporter gene in rat neuronal cells. Mir3120 also reduced expression of the HSC70 cochaperone auxilin (DNAJC6; 608375), another predicted MIR3120 target. Mir3120 reduced the surface content of clathrin-coated particles in hippocampal and cortical neurons. Scott et al. (2012) concluded that both MIR3120 and its host gene, DNM3, are involved in synaptic vesicle recycling.


▼ Mapping

Hartz (2012) mapped the MIR3120 gene to chromosome 1q24.3 based on an alignment of the mature MIR3120-5p sequence (CCUGUCUGUGCCUGCUGUACA) with the genomic sequence (GRCh37).

Scott et al. (2012) found that rat and human MIR3120 map to intron 13 of the DNM3 gene in the sense orientation. The MIR214 gene overlaps the MIR3120 gene in the antisense orientation in rat and human.


▼ REFERENCES

  1. Hartz, P. A. Personal Communication. Baltimore, Md. 7/2/2012.

  2. Scott, H., Howarth, J., Lee, Y. B., Wong, L.-F., Bantounas, I., Phylactou, L., Verkade, P., Uney, J. B. MiR-3120 is a mirror microRNA that targets heat shock cognate protein 70 and auxilin messenger RNAs and regulates clathrin vesicle uncoating. J. Biol. Chem. 287: 14726-14733, 2012. [PubMed: 22393045, images, related citations] [Full Text]


Creation Date:
Patricia A. Hartz : 7/16/2012
Edit History:
mgross : 07/16/2012

* 614722

MICRO RNA 3120; MIR3120


Alternative titles; symbols

miRNA3120
MIR3120-5p


Other entities represented in this entry:

MICRO RNA 3120-3p, INCLUDED; MIR3120-3p, INCLUDED

HGNC Approved Gene Symbol: MIR3120

Cytogenetic location: 1q24.3     Genomic coordinates (GRCh38): 1:172,138,808-172,138,888 (from NCBI)


TEXT

Description

MicroRNAs (miRNAs) are small noncoding RNAs that bind to complementary sequences in the 3-prime UTRs of target mRNAs and inhibit protein translation. The MIR3120 precursor stem-loop sequence encodes 2 mature miRNAs, MIR3120-5p and MIR3120-3p, from its 5-prime and 3-prime ends, respectively (Scott et al., 2012).


Cloning and Expression

Scott et al. (2012) cloned rat Mir3120, and by database analysis they identified human MIR3120. Northern blot analysis detected Mir3120 expression in day-12.5 mouse embryos. PCR analysis of cultured rat hippocampal neurons detected coexpression of Mir3120, its host gene Dnm3 (611445), and Mir214 (610721), which overlaps Mir3120 and Dnm3 on the opposite strand.


Gene Function

Scott et al. (2012) found that the 3-prime UTR of rat and human HSC70 (HSPA8; 600816) contains recognition sequences for both MIR3120-5p and MIR3120-3p. Overexpression of rat Mir3120 or a vector containing repeats of the MIR3120 recognition sequence reduced expression of Hsc70 and a human HSC70 reporter gene in rat neuronal cells. Mir3120 also reduced expression of the HSC70 cochaperone auxilin (DNAJC6; 608375), another predicted MIR3120 target. Mir3120 reduced the surface content of clathrin-coated particles in hippocampal and cortical neurons. Scott et al. (2012) concluded that both MIR3120 and its host gene, DNM3, are involved in synaptic vesicle recycling.


Mapping

Hartz (2012) mapped the MIR3120 gene to chromosome 1q24.3 based on an alignment of the mature MIR3120-5p sequence (CCUGUCUGUGCCUGCUGUACA) with the genomic sequence (GRCh37).

Scott et al. (2012) found that rat and human MIR3120 map to intron 13 of the DNM3 gene in the sense orientation. The MIR214 gene overlaps the MIR3120 gene in the antisense orientation in rat and human.


REFERENCES

  1. Hartz, P. A. Personal Communication. Baltimore, Md. 7/2/2012.

  2. Scott, H., Howarth, J., Lee, Y. B., Wong, L.-F., Bantounas, I., Phylactou, L., Verkade, P., Uney, J. B. MiR-3120 is a mirror microRNA that targets heat shock cognate protein 70 and auxilin messenger RNAs and regulates clathrin vesicle uncoating. J. Biol. Chem. 287: 14726-14733, 2012. [PubMed: 22393045] [Full Text: https://doi.org/10.1074/jbc.M111.326041]


Creation Date:
Patricia A. Hartz : 7/16/2012

Edit History:
mgross : 07/16/2012



NOTE: OMIM is intended for use primarily by physicians and other professionals concerned with genetic disorders, by genetics researchers, and by advanced students in science and medicine. While the OMIM database is open to the public, users seeking information about a personal medical or genetic condition are urged to consult with a qualified physician for diagnosis and for answers to personal questions.
OMIM® and Online Mendelian Inheritance in Man® are registered trademarks of the Johns Hopkins University.
Copyright® 1966-2024 Johns Hopkins University.

NOTE: OMIM is intended for use primarily by physicians and other professionals concerned with genetic disorders, by genetics researchers, and by advanced students in science and medicine. While the OMIM database is open to the public, users seeking information about a personal medical or genetic condition are urged to consult with a qualified physician for diagnosis and for answers to personal questions.
OMIM® and Online Mendelian Inheritance in Man® are registered trademarks of the Johns Hopkins University.
Copyright® 1966-2024 Johns Hopkins University.
Printed: April 24, 2024