Format
Items per page
Sort by

Send to:

Choose Destination

Links from GEO Profiles

Items: 1 to 20 of 200

1.
Value/Rank Plot

Uchl1 - Histone H3K27 methyltransferase Ezh2 deletion effect on primary preadipocyte cultures

Annotation:
Uchl1, ubiquitin carboxy-terminal hydrolase L1
Organism:
Mus musculus
Reporter:
GPL1261, 1448260_at (ID_REF), GDS3765, 22223 (Gene ID), NM_011670
DataSet type:
Expression profiling by array, count, 4 samples
2.
Value/Rank Plot

Uchl1 - Ligand screen in B cells: interleukin 10

Annotation:
Uchl1, ubiquitin carboxy-terminal hydrolase L1
Organism:
Mus musculus
Reporter:
GPL260, 9159 (ID_REF), GDS308, AK013729
DataSet type:
Expression profiling by array, log ratio, 11 samples
3.
Value/Rank Plot

Uchl1 - Ligand screen in B cells: antigen IgM

Annotation:
Uchl1, ubiquitin carboxy-terminal hydrolase L1
Organism:
Mus musculus
Reporter:
GPL260, 9159 (ID_REF), GDS292, AK013729
DataSet type:
Expression profiling by array, log ratio, 12 samples
4.
Value/Rank Plot

Uchl1 - Ligand screen in B cells: interleukin 4

Annotation:
Uchl1, ubiquitin carboxy-terminal hydrolase L1
Organism:
Mus musculus
Reporter:
GPL260, 9159 (ID_REF), GDS307, AK013729
DataSet type:
Expression profiling by array, log ratio, 12 samples
5.
Value/Rank Plot

Uchl1 - Ligand screen in B cells: dimaprit

Annotation:
Uchl1, ubiquitin carboxy-terminal hydrolase L1
Organism:
Mus musculus
Reporter:
GPL260, 9159 (ID_REF), GDS300, AK013729
DataSet type:
Expression profiling by array, log ratio, 12 samples
6.
Value/Rank Plot

Uchl1 - Ligand screen in B cells: CpG-oligodeoxynucleotide

Annotation:
Uchl1, ubiquitin carboxy-terminal hydrolase L1
Organism:
Mus musculus
Reporter:
GPL260, 9159 (ID_REF), GDS299, AK013729
DataSet type:
Expression profiling by array, log ratio, 12 samples
7.
Value/Rank Plot

Uchl1 - Ligand screen in B cells: formyl-Met-Leu-Phe

Annotation:
Uchl1, ubiquitin carboxy-terminal hydrolase L1
Organism:
Mus musculus
Reporter:
GPL260, 9159 (ID_REF), GDS302, AK013729
DataSet type:
Expression profiling by array, log ratio, 11 samples
8.
Value/Rank Plot

Uchl1 - MPSS transcriptome analysis project

Annotation:
Uchl1, ubiquitin carboxy-terminal hydrolase L1
Organism:
Mus musculus
Reporter:
GPL1010, GATCCCCCCTTCCCTGGGCA (ID_REF), GDS868, BC039177
DataSet type:
Expression profiling by MPSS, count, 87 samples
9.
Value/Rank Plot

Uchl1 - Ligand screen in B cells: untreated

Annotation:
Uchl1, ubiquitin carboxy-terminal hydrolase L1
Organism:
Mus musculus
Reporter:
GPL260, 9159 (ID_REF), GDS323, AK013729
DataSet type:
Expression profiling by array, log ratio, 41 samples
10.
Value/Rank Plot

Uchl1 - Heterozygous null CREB binding protein mutant response to environmental enrichment: hippocampus

Annotation:
Uchl1, ubiquitin carboxy-terminal hydrolase L1
Organism:
Mus musculus
Reporter:
GPL6246, 10522208 (ID_REF), GDS4486, NM_011670, AB025313, AF172334, AK170728, BC039177, chr5:66676241-66687234 (SPOT ID)
DataSet type:
Expression profiling by array, count, 16 samples
11.
Value/Rank Plot

Uchl1 - Dopaminergic transcription factors Ascl1, Lmx1a, Nurr1 combined effect on embryonic fibroblasts

Annotation:
Uchl1, ubiquitin carboxy-terminal hydrolase L1
Organism:
Mus musculus
Reporter:
GPL6246, 10522208 (ID_REF), GDS4155, NM_011670, AB025313, AF172334, AK170728, BC039177, chr5:66676241-66687234 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 8 samples
12.
Value/Rank Plot

Uchl1 - Ligand screen in B cells: B-cell activating factor

Annotation:
Uchl1, ubiquitin carboxy-terminal hydrolase L1
Organism:
Mus musculus
Reporter:
GPL260, 9159 (ID_REF), GDS293, AK013729
DataSet type:
Expression profiling by array, log ratio, 11 samples
13.
Value/Rank Plot

Uchl1 - Model for the manic pole of bipolar disorder: hippocampus

Annotation:
Uchl1, ubiquitin carboxy-terminal hydrolase L1
Organism:
Mus musculus
Reporter:
GPL6246, 10522208 (ID_REF), GDS4517, NM_011670, AB025313, AF172334, AK170728, BC039177, chr5:66676241-66687234 (SPOT ID)
DataSet type:
Expression profiling by array, count, 12 samples
14.
Value/Rank Plot

Uchl1 - 16p11.2 copy number variation models: various brain regions

Annotation:
Uchl1, ubiquitin carboxy-terminal hydrolase L1
Organism:
Mus musculus
Reporter:
GPL6246, 10522208 (ID_REF), GDS4430, NM_011670, AB025313, AF172334, AK170728, BC039177, chr5:66676241-66687234 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 37 samples
15.
Value/Rank Plot

Uchl1 - Ligand screen in B cells: 2-methyl-thio-ATP

Annotation:
Uchl1, ubiquitin carboxy-terminal hydrolase L1
Organism:
Mus musculus
Reporter:
GPL260, 9159 (ID_REF), GDS291, AK013729
DataSet type:
Expression profiling by array, log ratio, 11 samples
16.
Value/Rank Plot

Uchl1 - Ligand screen in B cells: leukotriene B4

Annotation:
Uchl1, ubiquitin carboxy-terminal hydrolase L1
Organism:
Mus musculus
Reporter:
GPL260, 9159 (ID_REF), GDS311, AK013729
DataSet type:
Expression profiling by array, log ratio, 12 samples
17.
Value/Rank Plot

Uchl1 - DSS-induced colitis model response to enhanced siRNA targeting of Tumor necrosis factor α

Annotation:
Uchl1, ubiquitin carboxy-terminal hydrolase L1
Organism:
Mus musculus
Reporter:
GPL6246, 10522208 (ID_REF), GDS4371, NM_011670, AB025313, AF172334, AK170728, BC039177, chr5:66676241-66687234 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 36 samples
18.
Value/Rank Plot

Uchl1 - Ligand screen in B cells: nerve growth factor

Annotation:
Uchl1, ubiquitin carboxy-terminal hydrolase L1
Organism:
Mus musculus
Reporter:
GPL260, 9159 (ID_REF), GDS313, AK013729
DataSet type:
Expression profiling by array, log ratio, 12 samples
19.
Value/Rank Plot

Uchl1 - Ligand screen in B cells: growth hormone releasing hormone

Annotation:
Uchl1, ubiquitin carboxy-terminal hydrolase L1
Organism:
Mus musculus
Reporter:
GPL260, 9159 (ID_REF), GDS303, AK013729
DataSet type:
Expression profiling by array, log ratio, 12 samples
20.
Value/Rank Plot

Uchl1 - Ubiquitin specific protease 22 depletion effect on embryonic stem cell line

Annotation:
Uchl1, ubiquitin carboxy-terminal hydrolase L1
Organism:
Mus musculus
Reporter:
GPL6246, 10522208 (ID_REF), GDS4973, NM_011670, AB025313, AF172334, AK170728, BC039177, chr5:66676241-66687234 (SPOT ID)
DataSet type:
Expression profiling by array, count, 4 samples
Format
Items per page
Sort by

Send to:

Choose Destination

Supplemental Content

Profile data

Download profile data help

Profile pathways

Find pathways help

Find related data

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk