Format
Items per page
Sort by

Send to:

Choose Destination

Links from GEO Profiles

Items: 1 to 20 of 200

1.
Value/Rank Plot

Tubb2a - Aryl hydrocarbon receptor deficiency effect on Langerhan cells

Annotation:
Tubb2a, tubulin, beta 2A class IIA
Organism:
Mus musculus
Reporter:
GPL339, 1427347_s_at (ID_REF), GDS3575, 22151 (Gene ID), BC003475
DataSet type:
Expression profiling by array, transformed count, 4 samples
2.
Value/Rank Plot

Tubb2a-ps2 - Regulatory, pathogenic and control CD4+ T cells

Annotation:
Tubb2a-ps2, tubulin, beta 2a, pseudogene 2 (multiple annotations exist)
Organism:
Mus musculus
Reporter:
GPL6246, 10399419 (ID_REF), GDS3999, NM_023716, BC138935, NR_003964, NM_009450, BC055441, chr12:11888133-11889470 (SPOT ID)
DataSet type:
Expression profiling by array, count, 8 samples
3.
Value/Rank Plot

Tubb2a - Hypertension model: liver

Annotation:
Tubb2a, tubulin, beta 2A class IIA
Organism:
Mus musculus
Reporter:
GPL9734, 100121292_TGI_at (ID_REF), GDS3674, NM_009450
DataSet type:
Expression profiling by array, count, 15 samples
4.
Value/Rank Plot

Tubb2a - Transcription factor STAT5b deficiency effect on the colon

Annotation:
Tubb2a, tubulin, beta 2A class IIA
Organism:
Mus musculus
Reporter:
GPL5759, NM_009450_at (ID_REF), GDS3385, NM_009450
DataSet type:
Expression profiling by array, transformed count, 8 samples
5.
Value/Rank Plot

Tubb2a - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:
Tubb2a, tubulin, beta 2A class IIA
Organism:
Mus musculus
Reporter:
GPL9734, 100121292_TGI_at (ID_REF), GDS4495, NM_009450
DataSet type:
Expression profiling by array, count, 9 samples
6.
Value/Rank Plot

Tubb2a - Atherosclerosis susceptibility model: macrophages

Annotation:
Tubb2a, tubulin, beta 2A class IIA
Organism:
Mus musculus
Reporter:
GPL9734, 100121292_TGI_at (ID_REF), GDS4527, NM_009450
DataSet type:
Expression profiling by array, count, 20 samples
7.
Value/Rank Plot

Tubb2a - Iron enriched and deficient diets effect on the liver

Annotation:
Tubb2a, tubulin, beta 2A class IIA
Organism:
Mus musculus
Reporter:
GPL4134, 146 (ID_REF), GDS3373, NM_009450, A_51_P490023 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 30 samples
8.
Value/Rank Plot

Tubb2a - Interleukin-22 effect on colon cultures

Annotation:
Tubb2a, tubulin, beta 2A class IIA
Organism:
Mus musculus
Reporter:
GPL2872, 27979 (ID_REF), GDS3226, NM_009450, A_51_P490023 (SPOT ID)
DataSet type:
Expression profiling by array, log10 ratio, 6 samples
9.
Value/Rank Plot

Tubb2b - MicroRNA miR-122 antisense inhibition effect on livers

Annotation:
Tubb2b, tubulin, beta 2B class IIB (multiple annotations exist)
Organism:
Mus musculus
Reporter:
GPL2897, 155079 (ID_REF), GDS1729, NM_023716, NM_009450
DataSet type:
Expression profiling by array, count, 10 samples
10.
Value/Rank Plot

Tubb2a - MPSS transcriptome analysis project

Annotation:
Tubb2a, tubulin, beta 2A class IIA
Organism:
Mus musculus
Reporter:
GPL1010, GATCACAGTATTGTCTCAGA (ID_REF), GDS868, NM_009450
DataSet type:
Expression profiling by MPSS, count, 87 samples
11.
Value/Rank Plot

Tubb2a - B7x effect on CD8 T cell-mediated diabetes model AI4αβ: pancreatic CD8 T cells

Annotation:
Tubb2a, tubulin, beta 2A class IIA
Organism:
Mus musculus
Reporter:
GPL6246, 10408610 (ID_REF), GDS4334, NM_009450, BC055441, chr13:34166147-34169857 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 6 samples
12.
Value/Rank Plot

Tubb2a - Cyclophosphamide effect on splenocytes: time course

Annotation:
Tubb2a, tubulin, beta 2A class IIA
Organism:
Mus musculus
Reporter:
GPL13209, 021O04 (ID_REF), GDS4005, NM_009450
DataSet type:
Expression profiling by array, log2 ratio, 38 samples
13.
Value/Rank Plot

Tubb2a - Hypertension model: heart

Annotation:
Tubb2a, tubulin, beta 2A class IIA
Organism:
Mus musculus
Reporter:
GPL9734, 100121292_TGI_at (ID_REF), GDS3673, NM_009450
DataSet type:
Expression profiling by array, count, 15 samples
14.
Value/Rank Plot

Tubb2a - Liver response to a high fat diet: time course

Annotation:
Tubb2a, tubulin, beta 2A class IIA
Organism:
Mus musculus
Reporter:
GPL6246, 10408610 (ID_REF), GDS4783, NM_009450, BC055441, chr13:34166147-34169857 (SPOT ID)
DataSet type:
Expression profiling by array, count, 36 samples
15.
Value/Rank Plot

Tubb2a - Sox9+ pancreatic cells: developmental time course

Annotation:
Tubb2a, tubulin, beta 2A class IIA
Organism:
Mus musculus
Reporter:
GPL6246, 10408610 (ID_REF), GDS4335, NM_009450, BC055441, chr13:34166147-34169857 (SPOT ID)
DataSet type:
Expression profiling by array, count, 15 samples
16.
Value/Rank Plot

Tubb2a - Developing testis and ovary

Annotation:
Tubb2a, tubulin, beta 2A class IIA
Organism:
Mus musculus
Reporter:
GPL6246, 10408610 (ID_REF), GDS3995, NM_009450, BC055441, chr13:34166147-34169857 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 91 samples
17.
Value/Rank Plot

Tubb2a - Hypertension model: aorta

Annotation:
Tubb2a, tubulin, beta 2A class IIA
Organism:
Mus musculus
Reporter:
GPL9734, 100121292_TGI_at (ID_REF), GDS3672, NM_009450
DataSet type:
Expression profiling by array, count, 23 samples
18.
Value/Rank Plot

Tubb2a - Iron enriched and deficient diets effect on the liver

Annotation:
Tubb2a, tubulin, beta 2A class IIA
Organism:
Mus musculus
Reporter:
GPL4134, 13112 (ID_REF), GDS3373, NM_009450, A_52_P621603 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 30 samples
19.
Value/Rank Plot

Tubb2a - 16p11.2 copy number variation models: various brain regions

Annotation:
Tubb2a, tubulin, beta 2A class IIA
Organism:
Mus musculus
Reporter:
GPL6246, 10408610 (ID_REF), GDS4430, NM_009450, BC055441, chr13:34166147-34169857 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 37 samples
20.
Value/Rank Plot

Tubb2a - Estradiol effect on the uterus: time course

Annotation:
Tubb2a, tubulin, beta 2A class IIA
Organism:
Mus musculus
Reporter:
GPL891, 21591 (ID_REF), GDS2208, NM_009450, A_51_P103659 (SPOT ID)
DataSet type:
Expression profiling by array, log10 ratio, 10 samples
Format
Items per page
Sort by

Send to:

Choose Destination

Supplemental Content

Profile data

Download profile data help

Profile pathways

Find pathways help

Find related data

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk