Format
Items per page
Sort by

Send to:

Choose Destination

Links from GEO Profiles

Items: 1 to 20 of 200

1.
Value/Rank Plot

Hspb1 - Rapid stimulation effect on an in vitro atrial (HL-1) myocyte model

Annotation:
Hspb1, heat shock protein 1
Organism:
Mus musculus
Reporter:
GPL1261, 1422943_a_at (ID_REF), GDS3564, 15507 (Gene ID), NM_013560
DataSet type:
Expression profiling by array, transformed count, 4 samples
2.
Value/Rank Plot

Hspb1 - MPSS transcriptome analysis project

Annotation:
Hspb1, heat shock protein 1
Organism:
Mus musculus
Reporter:
GPL1010, GATCACCATTCCGGTTACTT (ID_REF), GDS868, BC018257
DataSet type:
Expression profiling by MPSS, count, 87 samples
3.
Value/Rank Plot

Hspb1 - Histone deacetylase 3 deficiency effect on the heart

Annotation:
Hspb1, heat shock protein 1
Organism:
Mus musculus
Reporter:
GPL6246, 10526410 (ID_REF), GDS4886, NM_013560, BC018257, chr5:136363849-136365432 (SPOT ID)
DataSet type:
Expression profiling by array, count, 8 samples
4.
Value/Rank Plot

Hspb1 - Large-scale analysis of the mouse transcriptome (GNF1M)

Annotation:
Hspb1, heat shock protein 1
Organism:
Mus musculus
Reporter:
GPL1073, gnf1m10705_a_at (ID_REF), GDS592, BC018257
DataSet type:
Expression profiling by array, count, 122 samples
5.
Value/Rank Plot

Hspb1 - Embryonic fibroblast in vitro model of hypothermia: time course

Annotation:
Hspb1, heat shock protein 1
Organism:
Mus musculus
Reporter:
GPL6246, 10526410 (ID_REF), GDS5092, NM_013560, BC018257, chr5:136363849-136365432 (SPOT ID)
DataSet type:
Expression profiling by array, count, 13 samples
6.
Value/Rank Plot

Hspb1 - Pristane-induced arthritis effect on AIRmax and AIRmin acute inflammation model: footpad

Annotation:
Hspb1, heat shock protein 1
Organism:
Mus musculus
Reporter:
GPL6246, 10526410 (ID_REF), GDS5052, NM_013560, BC018257, chr5:136363849-136365432 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 8 samples
7.
Value/Rank Plot

Hspb1 - Ubiquitin specific protease 22 depletion effect on embryonic stem cell line

Annotation:
Hspb1, heat shock protein 1
Organism:
Mus musculus
Reporter:
GPL6246, 10526410 (ID_REF), GDS4973, NM_013560, BC018257, chr5:136363849-136365432 (SPOT ID)
DataSet type:
Expression profiling by array, count, 4 samples
8.
Value/Rank Plot

Hspb1 - Pancreatic cancer-induced cachexia model: muscle, liver and white adipose tissue

Annotation:
Hspb1, heat shock protein 1
Organism:
Mus musculus
Reporter:
GPL6246, 10526410 (ID_REF), GDS4899, NM_013560, BC018257, chr5:136363849-136365432 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 18 samples
9.
Value/Rank Plot

Hspb1 - TGFβ inhibitor effect on induced cardiomyocytes

Annotation:
Hspb1, heat shock protein 1
Organism:
Mus musculus
Reporter:
GPL6246, 10526410 (ID_REF), GDS4898, NM_013560, BC018257, chr5:136363849-136365432 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 27 samples
10.
Value/Rank Plot

Hspb1 - Heart response to isocitrate dehydrogenase 2 mutations IDH2R140Q and IDH2R172K

Annotation:
Hspb1, heat shock protein 1
Organism:
Mus musculus
Reporter:
GPL6246, 10526410 (ID_REF), GDS4893, NM_013560, BC018257, chr5:136363849-136365432 (SPOT ID)
DataSet type:
Expression profiling by array, count, 12 samples
11.
Value/Rank Plot

Hspb1 - Transcription factor treatment effect on embryonic fibroblasts

Annotation:
Hspb1, heat shock protein 1
Organism:
Mus musculus
Reporter:
GPL6246, 10526410 (ID_REF), GDS4835, NM_013560, BC018257, chr5:136363849-136365432 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 28 samples
12.
Value/Rank Plot

Hspb1 - H6 family homoebox 1 deficiency effect on the retina

Annotation:
Hspb1, heat shock protein 1
Organism:
Mus musculus
Reporter:
GPL6246, 10526410 (ID_REF), GDS4810, NM_013560, BC018257, chr5:136363849-136365432 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 8 samples
13.
Value/Rank Plot

Hspb1 - Pristane-induced arthritis effect on AIRmax high acute inflammation model: footpad

Annotation:
Hspb1, heat shock protein 1
Organism:
Mus musculus
Reporter:
GPL6246, 10526410 (ID_REF), GDS5050, NM_013560, BC018257, chr5:136363849-136365432 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 8 samples
14.
Value/Rank Plot

Hspb1 - Sex effect on acute coxsackievirus B3-induced myocarditis: heart

Annotation:
Hspb1, heat shock protein 1
Organism:
Mus musculus
Reporter:
GPL6246, 10526410 (ID_REF), GDS4311, NM_013560, BC018257, chr5:136363849-136365432 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 12 samples
15.
Value/Rank Plot

Hspb1 - Conjugated linoleic acid delipidative effect on obese line: time course

Annotation:
Hspb1, heat shock protein 1
Organism:
Mus musculus
Reporter:
GPL891, 6428 (ID_REF), GDS1360, BC018257, A_51_P477561 (SPOT ID)
DataSet type:
Expression profiling by array, log10 ratio, 4 samples
16.
Value/Rank Plot

Hspb1 - Neurofibromin inactivation effect on triceps muscle

Annotation:
Hspb1, heat shock protein 1
Organism:
Mus musculus
Reporter:
GPL6246, 10526410 (ID_REF), GDS4447, NM_013560, BC018257, chr5:136363849-136365432 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 8 samples
17.
Value/Rank Plot

Hspb1 - DSS-induced colitis model response to enhanced siRNA targeting of Tumor necrosis factor α

Annotation:
Hspb1, heat shock protein 1
Organism:
Mus musculus
Reporter:
GPL6246, 10526410 (ID_REF), GDS4371, NM_013560, BC018257, chr5:136363849-136365432 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 36 samples
18.
Value/Rank Plot

Hspb1 - Adrenergic stress effect on transcription factor GATA4 S105A mutants: heart ventricle

Annotation:
Hspb1, heat shock protein 1
Organism:
Mus musculus
Reporter:
GPL6246, 10526410 (ID_REF), GDS3931, NM_013560, BC018257, chr5:136363849-136365432 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 8 samples
19.
Value/Rank Plot

Hspb1 - Mepenzolate bromide effect on lung: time course

Annotation:
Hspb1, heat shock protein 1
Organism:
Mus musculus
Reporter:
GPL6246, 10526410 (ID_REF), GDS5057, NM_013560, BC018257, chr5:136363849-136365432 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 8 samples
20.
Value/Rank Plot

Hspb1 - Conventionalization of germ-free C57BL/6 males: time course

Annotation:
Hspb1, heat shock protein 1
Organism:
Mus musculus
Reporter:
GPL11533, 10526410 (ID_REF), GDS4319, NM_013560, BC018257, chr5:136363849-136365432 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 144 samples
Format
Items per page
Sort by

Send to:

Choose Destination

Supplemental Content

Profile data

Download profile data help

Profile pathways

Find pathways help

Find related data

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk