Format
Items per page
Sort by

Send to:

Choose Destination

Links from GEO Profiles

Items: 1 to 20 of 200

1.
Value/Rank Plot

Clu - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Clu, clusterin
Organism:
Mus musculus
Reporter:
GPL1010, GATCTTGTCTGTGGACTGTT (ID_REF), GDS878, BC075668
DataSet type:
Expression profiling by MPSS, count, 6 samples
2.
Value/Rank Plot

N4bp2l2 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
N4bp2l2, NEDD4 binding protein 2-like 2
Organism:
Mus musculus
Reporter:
GPL1010, GATCGCTACGAATTTCAAAT (ID_REF), GDS878, CF585004
DataSet type:
Expression profiling by MPSS, count, 6 samples
3.
Value/Rank Plot

Patz1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Patz1, POZ (BTB) and AT hook containing zinc finger 1
Organism:
Mus musculus
Reporter:
GPL1010, GATCCTGAGGTGGACCAGCA (ID_REF), GDS878, NM_019574
DataSet type:
Expression profiling by MPSS, count, 6 samples
4.
Value/Rank Plot

Ubl3 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Ubl3, Ubiquitin-like 3
Organism:
Mus musculus
Reporter:
GPL1010, GATCCTGTAGCGTCGCCAGC (ID_REF), GDS878, BU938123
DataSet type:
Expression profiling by MPSS, count, 6 samples
5.
Value/Rank Plot

Prrc2c - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Prrc2c, proline-rich coiled-coil 2C
Organism:
Mus musculus
Reporter:
GPL1010, GATCATAGAAAAGCAGCCAT (ID_REF), GDS878, BC006723
DataSet type:
Expression profiling by MPSS, count, 6 samples
6.
Value/Rank Plot

Napepld - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Napepld, N-acyl phosphatidylethanolamine phospholipase D
Organism:
Mus musculus
Reporter:
GPL1010, GATCTGTGGCGATTCACTGG (ID_REF), GDS878, AB112350
DataSet type:
Expression profiling by MPSS, count, 6 samples
7.
Value/Rank Plot

Syde1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Syde1, Synapse defective 1, Rho GTPase, homolog 1 (C. elegans)
Organism:
Mus musculus
Reporter:
GPL1010, GATCTTTGGTACGGAAAATA (ID_REF), GDS878, AW125745
DataSet type:
Expression profiling by MPSS, count, 6 samples
8.
Value/Rank Plot

Bcat1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Bcat1, branched chain aminotransferase 1, cytosolic
Organism:
Mus musculus
Reporter:
GPL1010, GATCTTTGCATCCTCAAAGC (ID_REF), GDS878, BC053706
DataSet type:
Expression profiling by MPSS, count, 6 samples
9.
Value/Rank Plot

Enkd1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Enkd1, enkurin domain containing 1
Organism:
Mus musculus
Reporter:
GPL1010, GATCACCACGTGGCTGCCAA (ID_REF), GDS878, NM_198299
DataSet type:
Expression profiling by MPSS, count, 6 samples
10.
Value/Rank Plot

Pacrgl - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Pacrgl, PARK2 co-regulated-like
Organism:
Mus musculus
Reporter:
GPL1010, GATCCCTGTGCTGAAGGCAG (ID_REF), GDS878, AK016966
DataSet type:
Expression profiling by MPSS, count, 6 samples
11.
Value/Rank Plot

Ctnnb1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Ctnnb1, Catenin (cadherin associated protein), beta 1
Organism:
Mus musculus
Reporter:
GPL1010, GATCACAAGATGGCGTTATC (ID_REF), GDS878, CK030845
DataSet type:
Expression profiling by MPSS, count, 6 samples
12.
Value/Rank Plot

Hexdc - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Hexdc, hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing
Organism:
Mus musculus
Reporter:
GPL1010, GATCTGCTGCAGGACCTGGG (ID_REF), GDS878, NM_001001333
DataSet type:
Expression profiling by MPSS, count, 6 samples
13.
Value/Rank Plot

Jag1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Jag1, jagged 1
Organism:
Mus musculus
Reporter:
GPL1010, GATCCAGGTTCACCACCGGG (ID_REF), GDS878, NM_013822
DataSet type:
Expression profiling by MPSS, count, 6 samples
14.
Value/Rank Plot

Id4 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Id4, inhibitor of DNA binding 4
Organism:
Mus musculus
Reporter:
GPL1010, GATCCTGCAGCACGTTATCG (ID_REF), GDS878, AK041164
DataSet type:
Expression profiling by MPSS, count, 6 samples
15.
Value/Rank Plot

Pcdh7 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Pcdh7, Protocadherin 7
Organism:
Mus musculus
Reporter:
GPL1010, GATCCCCAACACCCACCCTC (ID_REF), GDS878, AW047051
DataSet type:
Expression profiling by MPSS, count, 6 samples
16.
Value/Rank Plot

Mterf1a - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Mterf1a, mitochondrial transcription termination factor 1a
Organism:
Mus musculus
Reporter:
GPL1010, GATCCCAGAGATTTTGTCAG (ID_REF), GDS878, NM_001013023
DataSet type:
Expression profiling by MPSS, count, 6 samples
17.
Value/Rank Plot

E130317F20Rik - MPSS analysis of BLK CL.4 and liver cells

Annotation:
E130317F20Rik, RIKEN cDNA E130317F20 gene
Organism:
Mus musculus
Reporter:
GPL1010, GATCCTTTGGTAGGACTCCC (ID_REF), GDS878, AK053875
DataSet type:
Expression profiling by MPSS, count, 6 samples
18.
Value/Rank Plot

Anxa6 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Anxa6, Annexin A6
Organism:
Mus musculus
Reporter:
GPL1010, GATCCTTCGAGCTCTAAGCC (ID_REF), GDS878, BB036305
DataSet type:
Expression profiling by MPSS, count, 6 samples
19.
Value/Rank Plot

Rpain - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Rpain, RPA interacting protein
Organism:
Mus musculus
Reporter:
GPL1010, GATCCTCTAGCCATCCCGAC (ID_REF), GDS878, NM_027186
DataSet type:
Expression profiling by MPSS, count, 6 samples
20.
Value/Rank Plot

Rab6b - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Rab6b, RAB6B, member RAS oncogene family
Organism:
Mus musculus
Reporter:
GPL1010, GATCTTTCTTTTCTCTCTCT (ID_REF), GDS878, AK035893
DataSet type:
Expression profiling by MPSS, count, 6 samples
Format
Items per page
Sort by

Send to:

Choose Destination

Supplemental Content

Profile data

Download profile data help

Profile pathways

Find pathways help

Find related data

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk