Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information

    Results: 1 to 20 of 200

    1.
    Value/Rank Plot

    Cfl1 - MPSS analysis of BLK CL.4 and liver cells

    Annotation:
    Cfl1, Cofilin 1, non-muscle
    Organism:
    Mus musculus
    Reporter:
    GPL1010, GATCAAAGGAAAGGGGAGGG (ID_REF), GDS878, BY473497
    DataSet type:
    Expression profiling by MPSS, count, 6 samples
    2.
    Value/Rank Plot

    Hpgd - MPSS analysis of BLK CL.4 and liver cells

    Annotation:
    Hpgd, hydroxyprostaglandin dehydrogenase 15 (NAD)
    Organism:
    Mus musculus
    Reporter:
    GPL1010, GATCACGGCATCGAAAGGAA (ID_REF), GDS878, BC021157
    DataSet type:
    Expression profiling by MPSS, count, 6 samples
    3.
    Value/Rank Plot

    Nt5dc3 - MPSS analysis of BLK CL.4 and liver cells

    Annotation:
    Nt5dc3, 5'-nucleotidase domain containing 3
    Organism:
    Mus musculus
    Reporter:
    GPL1010, GATCACATGCCTTTCCTGGG (ID_REF), GDS878, BC020154
    DataSet type:
    Expression profiling by MPSS, count, 6 samples
    4.
    Value/Rank Plot

    Aph1b - MPSS analysis of BLK CL.4 and liver cells

    Annotation:
    Aph1b, anterior pharynx defective 1b homolog (C. elegans)
    Organism:
    Mus musculus
    Reporter:
    GPL1010, GATCCAGCTTCAGGGCCAAT (ID_REF), GDS878, NM_177583
    DataSet type:
    Expression profiling by MPSS, count, 6 samples
    5.
    Value/Rank Plot

    Prkag2 - MPSS analysis of BLK CL.4 and liver cells

    Annotation:
    Prkag2, Protein kinase, AMP-activated, gamma 2 non-catalytic subunit
    Organism:
    Mus musculus
    Reporter:
    GPL1010, GATCCTCACACCAGCAGGTG (ID_REF), GDS878, AI854673
    DataSet type:
    Expression profiling by MPSS, count, 6 samples
    6.
    Value/Rank Plot

    Zadh2 - MPSS analysis of BLK CL.4 and liver cells

    Annotation:
    Zadh2, zinc binding alcohol dehydrogenase, domain containing 2
    Organism:
    Mus musculus
    Reporter:
    GPL1010, GATCATGCCGAAGTGTCACA (ID_REF), GDS878, AK083082
    DataSet type:
    Expression profiling by MPSS, count, 6 samples
    7.
    Value/Rank Plot

    Zc3h7b - MPSS analysis of BLK CL.4 and liver cells

    Annotation:
    Zc3h7b, zinc finger CCCH type containing 7B
    Organism:
    Mus musculus
    Reporter:
    GPL1010, GATCTGCGAAAGGGGCAAGG (ID_REF), GDS878, BC059923
    DataSet type:
    Expression profiling by MPSS, count, 6 samples
    8.
    Value/Rank Plot

    Fiz1 - MPSS analysis of BLK CL.4 and liver cells

    Annotation:
    Fiz1, Flt3 interacting zinc finger protein 1
    Organism:
    Mus musculus
    Reporter:
    GPL1010, GATCTTCCCCCATCCTGAAC (ID_REF), GDS878, NM_011813
    DataSet type:
    Expression profiling by MPSS, count, 6 samples
    9.
    Value/Rank Plot

    Atrx - MPSS analysis of BLK CL.4 and liver cells

    Annotation:
    Atrx, Alpha thalassemia/mental retardation syndrome X-linked homolog (human)
    Organism:
    Mus musculus
    Reporter:
    GPL1010, GATCAACAGCAGGTTGAGCG (ID_REF), GDS878, AU020299
    DataSet type:
    Expression profiling by MPSS, count, 6 samples
    10.
    Value/Rank Plot

    Cuta - MPSS analysis of BLK CL.4 and liver cells

    Annotation:
    Cuta, cutA divalent cation tolerance homolog (E. coli)
    Organism:
    Mus musculus
    Reporter:
    GPL1010, GATCTGTGCACCCTTATGAA (ID_REF), GDS878, NM_026307
    DataSet type:
    Expression profiling by MPSS, count, 6 samples
    11.
    Value/Rank Plot

    Ino80e - MPSS analysis of BLK CL.4 and liver cells

    Annotation:
    Ino80e, INO80 complex subunit E
    Organism:
    Mus musculus
    Reporter:
    GPL1010, GATCGACATTCCAGAGTAGC (ID_REF), GDS878, NM_153580
    DataSet type:
    Expression profiling by MPSS, count, 6 samples
    12.
    Value/Rank Plot

    MPSS analysis of BLK CL.4 and liver cells

    Annotation:
    No annotation available
    Organism:
    Mus musculus
    Reporter:
    GPL1010, GATCAGGAGCCAGGGAGCTA (ID_REF), GDS878
    DataSet type:
    Expression profiling by MPSS, count, 6 samples
    13.
    Value/Rank Plot

    Txnl1 - MPSS analysis of BLK CL.4 and liver cells

    Annotation:
    Txnl1, Thioredoxin-like 1
    Organism:
    Mus musculus
    Reporter:
    GPL1010, GATCTATGGATTTTGAGGAT (ID_REF), GDS878, AI152735
    DataSet type:
    Expression profiling by MPSS, count, 6 samples
    14.
    Value/Rank Plot

    Zbtb24 - MPSS analysis of BLK CL.4 and liver cells

    Annotation:
    Zbtb24, Zinc finger and BTB domain containing 24
    Organism:
    Mus musculus
    Reporter:
    GPL1010, GATCAGAACTGGCTGCAGAG (ID_REF), GDS878, BU510544
    DataSet type:
    Expression profiling by MPSS, count, 6 samples
    15.
    Value/Rank Plot

    Traf3 - MPSS analysis of BLK CL.4 and liver cells

    Annotation:
    Traf3, TNF receptor-associated factor 3
    Organism:
    Mus musculus
    Reporter:
    GPL1010, GATCGTGACCAGTGATTAGC (ID_REF), GDS878, NM_011632
    DataSet type:
    Expression profiling by MPSS, count, 6 samples
    16.
    Value/Rank Plot

    BC003331 - MPSS analysis of BLK CL.4 and liver cells

    Annotation:
    BC003331, CDNA sequence BC003331
    Organism:
    Mus musculus
    Reporter:
    GPL1010, GATCGCTGTGAAATACTCTT (ID_REF), GDS878, AI451976
    DataSet type:
    Expression profiling by MPSS, count, 6 samples
    17.
    Value/Rank Plot

    Ywhag - MPSS analysis of BLK CL.4 and liver cells

    Annotation:
    Ywhag, Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamm...
    Organism:
    Mus musculus
    Reporter:
    GPL1010, GATCCTCTTCAGCCCTGTGA (ID_REF), GDS878, BB614735
    DataSet type:
    Expression profiling by MPSS, count, 6 samples
    18.
    Value/Rank Plot

    Stambpl1 - MPSS analysis of BLK CL.4 and liver cells

    Annotation:
    Stambpl1, STAM binding protein like 1
    Organism:
    Mus musculus
    Reporter:
    GPL1010, GATCTGAGGTGACATGCCCT (ID_REF), GDS878, NM_029682
    DataSet type:
    Expression profiling by MPSS, count, 6 samples
    19.
    Value/Rank Plot

    MPSS analysis of BLK CL.4 and liver cells

    Annotation:
    Transcribed locus
    Organism:
    Mus musculus
    Reporter:
    GPL1010, GATCCTTGCCCTTCTAAGCA (ID_REF), GDS878, AW112113
    DataSet type:
    Expression profiling by MPSS, count, 6 samples
    20.
    Value/Rank Plot

    MPSS analysis of BLK CL.4 and liver cells

    Annotation:
    No annotation available
    Organism:
    Mus musculus
    Reporter:
    GPL1010, GATCACCAGTGGGCGCTCGA (ID_REF), GDS878
    DataSet type:
    Expression profiling by MPSS, count, 6 samples

      Display Settings:

      Format
      Items per page
      Sort by

      Send to:

      Choose Destination

      Supplemental Content

      Profile data

      Download profile data help

      Profile pathways

      Find pathways help

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Write to the Help Desk