 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 07, 2011 |
| Title |
Breast_ILC_40 |
| Sample type |
SRA |
| |
|
| Source name |
Breast tissue
|
| Organism |
Homo sapiens |
| Characteristics |
tissue: Breast
disease status: ILC
ID: 40
esr/er ihc (1=positive, 0=negative): 1
pgr/pr ihc (1=positive, 0=negative): 1
|
| Growth protocol |
Tissues Collected from patients; Cell lines grown according to ATCC recommendations.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Fresh-frozen (frozen immediately after surgery and stored at -80C) normal and tumor tissue was collected. RNA was isolated from approximately thirty 30-um cryosections corresponding to approximately 20 mg of tissue, using the first and last section to assess tumor content; only samples containing more than 50% tumor were further characterized. The tissues were homogenized in Trizol using a Polytron instrument (polytron, PT, MR2100, Kinematica AG, Luzern) for 1 min and total RNA was isolated by a modified Trizol protocol (acidic phenol:chloroform:IAA (25:24:1) extraction, precipitated with 2M NaOAc pH 4.2 and Ethanol). Quality of isolated RNA was assessed on a 1% agarose gel based on the relative abundance of 18S and 28S subunits of ribosomal RNA. We used a barcoded small RNA sequencing approach (Hafner 2011). Briefly, in a total reaction volume of 20 ul, 2 ug total RNA was ligated to 100 pmol adenylated 3' adapter containing a unique pentamer barcode (App-(Barcode)TCGTATGCCGTCTTCTGCTTGT), 1 ug Rnl2(1-249)K227Q (plasmid for expression of recombinant ligase is available at www.addgene.org) in 50 mM Tris-HCl, pH 7.6, 10 mM MgCl2, 10 mM 2-mercaptoethanol, 0.1 mg/ml acetylated BSA (Sigma, St. Louis, MO), and 15% DMSO for 16 h on ice. Barcodes are listed in this table. Following 3' adapter ligation, 20 barcoded samples were pooled and products were purified on a 15% denaturing polyacylamide gel. Small RNAs, measuring 45-50 nt in length, were excised from the gel, eluted, and ligated to 100 pmol 5' oligoribonucleotide adapter (GUUCAGAGUUCUACAGUCCGACGAUC) in a 20 ul reaction volume using 1 ug Rnl1 RNA ligase in 50 mM Tris-HCl, pH 7.6, 10 mM MgCl2, 10 mM 2-mercaptoethanol, 0.2 mg/ml acetylated BSA, 0.1 mg/ml acetylated BSA, 0.2 mM ATP, and 15% DMSO for 1 h at 37C. Ligated small RNAs were purified on a 12% polyacrylamide gel, reverse transcribed using SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA), and amplified by PCR using appropriate primers (forward primer: AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA; RT and reverse primer: CAAGCAGAAGACGGCATACGA). cDNA libraries were sequenced by Solexa technology at the Rockefeller University Genomics Resource Center. To selected samples we added in total 2.5 or 3.4 fmol of a cocktail of 10 calibrator oligoribonucleotides per ug of total RNA (for sequences see (Hafner 2011)).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer IIx |
| |
|
| Description |
40
genomic small RNA (size selected RNA from total RNA)
See Supplementary Table S1 and S2 for further sample information
|
| Data processing |
We processed all samples by 3'-adapter barcoded small RNA cDNA library Solexa sequencing (library construction). 61,319,767 sequence reads were extracted from barcodes yielding a median of 134,022 reads per sample (range: 7,403-1,608,855); these reads were mapped to the genome allowing one mismatch/insertion/deletion and then to our non-coding RNA and miRNA databases allowing up to two mismatches or one insertion/deletion (22). We constructed a miRNA read database from over 1,000 human samples sequenced in the Tuschl laboratory, defined prototypical miRNAs (557 precursors, corresponding to 1112 mature and star sequences, miR-451 and miR-618 being the only miRNAs without a star sequence), added 269 not yet reported star sequences, ignored putative miRNAs from miRBase for which we did not obtain read evidence and renamed specific miRNAs according to the read ratio between mature/star sequences (Tuschl, unpublished data).
Note: Not all subsamples from each sequencing run were used for this project. We did not include these subsamples in the unassigned read files if they contained a barcode. Unasigned reads are reads that were not able to be mathced to any barcode. Unassigned read files are attached to the Series record.
|
| |
|
| Submission date |
Apr 27, 2011 |
| Last update date |
May 15, 2019 |
| Contact name |
Thalia Farazi |
| E-mail(s) |
tfarazi@rockefeller.edu
|
| Phone |
212-327-7644
|
| Organization name |
Rockefeller University
|
| Department |
Lab of RNA Molecular Biology
|
| Lab |
Tuschl
|
| Street address |
1230 York Ave, BOX 186
|
| City |
New York |
| State/province |
NY |
| ZIP/Postal code |
10065 |
| Country |
USA |
| |
|
| Platform ID |
GPL10999 |
| Series (2) |
| GSE28884 |
MicroRNA sequence and expression analysis in breast tumors by deep sequencing |
| GSE29173 |
MicroRNA sequence and expression analysis in breast tumors by deep sequencing [miRNA sequence data] |
|
| Relations |
| SRA |
SRX059413 |
| BioSample |
SAMN00262290 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM715528_40_geo.txt.gz |
125.0 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Raw data are available on Series record |
|
|
|
|
 |
