|
Status |
Public on May 29, 2012 |
Title |
F2 hybrid replicate 2 |
Sample type |
SRA |
|
|
Source name |
young seedlings aerial tissue
|
Organism |
Solanum lycopersicum x Solanum pennellii |
Characteristics |
tissue: young seedlings aerial tissue 3'adapter: TCGTATGCCGTCTTCTGCTTGT
|
Treatment protocol |
Small RNAs were isolated from different lines of 2 week old Tomato seedlings.
|
Growth protocol |
Tomato seedlings were grown in Conviron growth chambers at 23'C, 60% RH and 16/8 light cycle in high nutrient compost.
|
Extracted molecule |
total RNA |
Extraction protocol |
Total RNA was extracted using Trizol (Invitrogen) and small RNA fraction was separated by PAGE gel. Adapter sequences appropriate for Illumina sequencing were ligated.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina Genome Analyzer |
|
|
Data processing |
Sequence reads were obtained using the Illumina Genome Analyzer Pipeline. The 3 prime adaptor sequence was removed from the small RNA reads and the reads were aligned to the Tomato genome version bacs v340. Only reads with 100% match to the genome were retained.
|
|
|
Submission date |
Aug 11, 2010 |
Last update date |
May 15, 2019 |
Contact name |
Krys Kelly |
Organization name |
University of Cambridge
|
Department |
Plant Sciences
|
Lab |
Baulcombe Group
|
Street address |
Downing Street
|
City |
Cambridge |
ZIP/Postal code |
CB2 3EA |
Country |
United Kingdom |
|
|
Platform ID |
GPL10777 |
Series (1) |
GSE23562 |
Small RNA profiling Tomato, wild tomato relative and series of introgression lines |
|
Relations |
SRA |
SRX026456 |
BioSample |
SAMN00110633 |