|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Feb 07, 2014 |
Title |
HL-ASE-cDNAH16_Ind26-Aug18 |
Sample type |
SRA |
|
|
Source name |
polyclonal cell line GM13130
|
Organism |
Homo sapiens |
Characteristics |
cell line source: polyclonal cell line GM13130 clone id: H16 molecule subtype: cDNA
|
Biomaterial provider |
http://ccr.coriell.org/Sections/Search/Search.aspx?PgId=165&q=GM13130
|
Extracted molecule |
total RNA |
Extraction protocol |
DNA - Qiagen Blood Mini kit, RNA - Nuclei PURE Prep Sigma Aldrich NUC201, ChIP as described in PMID 16630819; 17603471. Antibodies used are AB9050 from Abcam for H3K36me3 mark and ABE44 from Millipore for H3K27me3 mark. cDNA synthesis was done after Turbo Dnase treatment according to manufacturer instruction for SuperScript III To capture the targeted coding SNPs, mixture containing Padlock probes targeting 36,456 common coding SNPs and 200 ng of genomic DNA (or cDNA, ChIPed-DNA) was prepared in 1X Ampligase Buffer (Epicentre) (Zhang et al., 2009). The mixture was denatured at 95°C, gradually cooled and then hybridized at 60°C for 24 hours. The product was circularized after adding AmpliTaq Stoffel (Life Technology), and Ampligase (Epicentre), in presence of dNTPs, and incubating at 60°C for 18 hours. Following this exonuclease I (USB) and exonuclease III (USB) was added to cleave the linear DNA by incubating at 37°C for 2 hours and followed by heat inactivation at 90°C. The circularization product was amplified using primer AmpF6.3Sol: AATGATACGGCGACCACCGACACTCTCAGATGTTATCGAGGTCCGAC), AmpR6.3Ind in Kapa SYBR FAST qPCR master mix (Kapa Biosystems) using the following program: 95 °C for 2 minutes, and then 6 cycles at 98°C for 20 seconds, 58°C for 20 seconds, 72°C for 20 seconds followed by 20 cycles at 98°C for 10 seconds and 72°C for 20 seconds. PCR reaction was terminated before the real time PCR curve reached plateau to avoid over-amplification. The amplicons were purified using Qiaquick PCR purification kit (Qiagen), and products in the expected size range (180bp) were selected using polyacrylamide (PAGE) gel. The libraries were sequenced on an Illumina Genome Analyzer IIx. PMID 19620972
|
|
|
Library strategy |
OTHER |
Library source |
transcriptomic |
Library selection |
other |
Instrument model |
Illumina Genome Analyzer IIx |
|
|
Description |
cDNA of polyclonal cell line GM13130 clone H16 SRX400146 processed data file: H16.txt
|
Data processing |
library strategy: padlock probe targeted library (digital RNA allelotyping method; ultra-deep sequencing of padlock captured SNPs from the transcriptome) Basecalls performed using RTA version 1.13 Sequencing reads were trimmed to remove the targeting arms of padlock probes Mapped to reference genome using samtools version 0.1.18 Variant called using GATK version 1.4-1 hg18 processed data files format and content: allelic table text tile
|
|
|
Submission date |
Feb 06, 2014 |
Last update date |
May 15, 2019 |
Contact name |
Kun Zhang |
Organization name |
UCSD
|
Department |
Bioengineering
|
Lab |
Zhang Lab
|
Street address |
9450 Gilman Drive
|
City |
La Jolla |
State/province |
CA |
ZIP/Postal code |
92092-0100 |
Country |
USA |
|
|
Platform ID |
GPL10999 |
Series (1) |
GSE53628 |
Analysis of Allelic bias in gDNA, cDNA and ChIP with H3K27me3 and H3K36me3 antibody with multiplexed padlock probe approach |
|
Relations |
BioSample |
SAMN02629954 |
SRA |
SRX400146 |
Supplementary data files not provided |
SRA Run Selector |
Processed data are available on Series record |
Raw data are available in SRA |
|
|
|
|
|