|
| Status |
Public on Nov 09, 2012 |
| Title |
CD4+ T cells, WT, biological rep2 |
| Sample type |
SRA |
| |
|
| Source name |
In vitro activated CD4+ T cells from spleen and lymph nodes
|
| Organism |
Mus musculus |
| Characteristics |
strain: C57BL/6
genotype/variation: WT
cell type: CD4+ T cells [activated]
antibody: anti-AGO2 (a custom rabbit polyclonal antibody generated with the following peptide: MYS GAG PVL ASP APT TSP IPG YAFKC)
3' linker: 3' Linker 2
|
| Treatment protocol |
CD4+ T cells were activated upon culture in the presence of 1ug/mL CD3 and CD28 antibodies in 20U/mL IL-2 for 4 days at 37C, 5% CO2.
|
| Growth protocol |
CD4+ T cells were isolated using CD4 dynabeads (Invitrogen) according to the manufacture's instructions.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cells were lysed and treated with limiting RNAse. AGO-RNA complexes were immunoprecipitated with AGO2 antibody. Immunoprecipitated samples were separated by SDS-PAGE and transferred to nitrocellulose. Libraries were constructed from complexes that ran at ~100-150kD.
3' RNA linkers were ligated while Ago complexes were complexed to IP beads. 5' RNA linkers were ligated following proteinase K digestion of nitrocellulose bound complexes. Reverse transcription was performed with a primer containing a 5nt multiplexing index and 6nt degenerate barcode. Following library amplification, libraries were size selected on agarose gels to enrich for inserts.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina Genome Analyzer IIx |
| |
|
| Description |
Nucleotides 1-6 of the read are degenerate barcode that were appended from an index read, the subsequent nucleotides correspond to the Argonaute bound RNA
read.TCCAC_wt2
|
| Data processing |
Before data was deposited in GEO it was demultiplexed and the degenerate barcode from the index read was appended to the beginning of the read (it is the first six nucleotides of the reads deposited here).
The 3' ends of reads were trimmed until the base quality score was >20. FASTX-Toolkit: fastq_quality_trimmer -t 20 -l 20
3' Linker sequences were clipped (linker1= GTGTCTTTACACAGCTACGGCGTCG; linker2= GTGTCACTGATAGCAACCCGGTGCT). FASTX-Toolkit: fastx_clipper -a GTGTCTTTACACAGCTACGGCGTCG -l 20 -M 4; fastx_clipper -a GTGTCACTGATAGCAACCCGGTGCT -l 20 -M 4
Remove any reads with adapter sequence fragments (custom perl script): CGACCAGCAT, GTGTCTTTAC, GTGTCACTGA
Reads were consolidated -- that is we merged identical reads with identical barcodes in nt. pos. 1-6 of each read.
We aligned reads (starting with the seventh nucleotide to avoid the degenerate barcode) uniquely to the mm9 Mouse genome with up to one mismatch. (Bowtie 0.12.7): mm9 -5 6 -v 1 --tryhard -a -m 1 --best --strata
UTR mapping, normalization, peak calling and detection of differential binding was performed using custom tools. See supplementry computational methods (linked to Series record as supplementary file) for details.
Supplementry computational methods also available from: http://homes.uchicago.edu/~aakhan/clip_supplemental.pdf
Genome_build: mm9
Supplementary_files_format_and_content: File clip_peaks.txt contains all 3'UTR peaks called from the data--all called peaks had binding in at least 7 out of 12 wild type or 155KO replicates. File clip_peaks.txt is linked as a supplementary file on the Series record.
|
| |
|
| Submission date |
Oct 02, 2012 |
| Last update date |
May 15, 2019 |
| Contact name |
Aly Azeem Khan |
| Organization name |
University of Chicago
|
| Street address |
6045 S. Kenwood Ave.
|
| City |
Chicago |
| State/province |
IL |
| ZIP/Postal code |
60637 |
| Country |
USA |
| |
|
| Platform ID |
GPL11002 |
| Series (2) |
| GSE41285 |
Transcriptome-wide miR-155 binding map reveals widespread non-canonical microRNA targeting [CLIP-seq data] |
| GSE41288 |
Transcriptome-wide miR-155 binding map reveals widespread non-canonical microRNA targeting |
|
| Relations |
| SRA |
SRX190884 |
| BioSample |
SAMN01737735 |
