 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 06, 2015 |
| Title |
eIF3 PAR-CLIP in 293T cells |
| Organism |
Homo sapiens |
| Experiment type |
Other
|
| Summary |
Regulation of protein synthesis is fundamental for all aspects of eukaryotic biology by controlling development, homeostasis, and stress responses. The 13-subunit, 800-kDa eukaryotic initiation factor 3 (eIF3) organizes initiation factor and ribosome interactions required for productive translation. However, current understanding of eIF3 function does not explain genetic evidence correlating eIF3 deregulation with tissue-specific cancers and developmental defects. Here we report the genome-wide discovery of human transcripts that interact with eIF3 using photo-activatable crosslinking and immunoprecipitation (PAR-CLIP). eIF3 binds to a highly specific programme of messenger RNAs (mRNAs) involved in cell growth control processes, including cell cycling, differentiation, and apoptosis, via the mRNA 5' untranslated region (5' UTR). Surprisingly, functional analysis of the interaction between eIF3 and two mRNAs encoding cell proliferation regulators, c-Jun and BTG1, reveals that eIF3 employs different modes of RNA stem loop binding to exert either translational activation or repression. Our findings illuminate a new role for eIF3 in governing a specialized repertoire of gene expression and suggest that binding of eIF3 to specific mRNAs could be targeted to control carcinogenesis.
|
| |
|
| Overall design |
293T cells were treated with 4-thiouridine and protein-RNA complexes were crosslinked, and eIF3-RNA complexes were immunoprecipitated.
Replicate 1 includes use of primer ID on the 5' end ("NNNNNNNNGUAC").
The 3' adapter used for all samples was:
5’ rApp /TGGAATTCTCGGGTGCCAAGG/ 3ddC/
|
| |
|
| Contributor(s) |
Lee AS |
| Citation(s) |
25849773 |
| Submission date |
Jan 15, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Amy Si-Ying Lee |
| Organization name |
DFCI
|
| Department |
Cancer Immunology and Virology
|
| Street address |
450 Brookline Ave SM520
|
| City |
Boston |
| State/province |
MA |
| ZIP/Postal code |
02215 |
| Country |
USA |
| |
|
| Platforms (1) |
| GPL11154 |
Illumina HiSeq 2000 (Homo sapiens) |
|
| Samples (12)
|
|
| Relations |
| BioProject |
PRJNA272706 |
| SRA |
SRP052300 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSE65004_PARCLIP.txt.gz |
22.3 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
Less...
More...