NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL6917 Query DataSets for GPL6917
Status Public on Jun 10, 2008
Title Cotton Fiber Oligonucleotide Microarray.V1
Technology type spotted oligonucleotide
Distribution custom-commercial
Organism Gossypium arboreum
Manufacturer University Of California-Davis
Manufacture protocol Oligonucleotides (oligoNT [70-mers]) were synthesized by Operon Technologies against 12,227 NR fiber ESTs. The cotton fiber microarray platform was fabricated, at CFGC-UCD, by spotting oligo NTs (40 um) in 50% DMSO in duplicates on Corning Ultra GAPS II microarray slides in 23 X 23 subarrays using the Omni Grid arrayer (Genomic Solutions) equipped with 16 (4X4) MicroQuill pins (Majer Precision Engineering).Post-printing processing of slides to chemically cross-link oligomers was performed according to the slide manufacturer’s instructions.
Support glass
Coating other
 
Description Cotton fiber ESTs were generated from 7-10 dpa fibers from the diploid species, Gossypium arboreum L. cv. AKA8401, at the Cotton Functional Genomic Center (CFGC) at the University of California-Davis (UCD) (cfgc.ucdavis.edu). A Unigene (UG)/Non-redundant (NR) set of 13,947 quality-controlled consensus sequences that define the cotton fiber transcriptome during rapid fiber elongation was assembled by Arpat et al 2004. The UG/NR set was used for designing oligonucleotide probes. A set of 12,227 Oligonucleotides (70-mer) were designed and synthesized by Operon Technologies (Operon, USA). Besides the cotton fiber oligos, the array comprised 71 experimental controls (positives, negatives, internals), transgene and vector controls, six spike-inn controls (Alien Spike mRNA, Stratagene), and blank and buffer controls spotted and replicated ≥ 2. Additional controls included cotton sequences deposited in GenBank, but not found in fiber dbEST.
 
Web link http://omics.hpcc.ttu.edu/; http://genomics.ttu.edu/; http://cfgc.ucdavis.edu
Contributor(s) Wilkins TA, Arpat BA, Alabady MS, Sickler B
Citation(s) 15604659
Submission date Jun 02, 2008
Last update date Jun 10, 2008
Contact name Thea A Wilkins
URL http://genomics.ttu.edu
Organization name Texas Tech University
Department Plant and Soil Sciences
Lab Plant Functional Genomics Lab
Street address 2500 Broadway,Campus Box 42122
City Lubbock
State/province TX
ZIP/Postal code TX 79409
Country USA
 
Samples (12) GSM296850, GSM296851, GSM296852, GSM296853, GSM296854, GSM296855 
Series (2)
GSE11689 Expression profiling of cotton (Gossypium barbadense L. Pima S7) fiber transcriptome during the development
GSE11693 Expression profiling of cotton (Gossypium hirsutum L. TM1) fiber transcriptome during the development

Data table header descriptions
ID
Short Probe_ID A shortened form of the ID.
GenBank _ProtACC The GenBank Protein Accession number, which were identified by blasting cotton fiber unigene set against GenBank Unigene database (Annotation field)
Probe_Sequence The Probe nucleotide sequences (mostly 70 mers)
GenBank_NucACC The GenBank Nucleotied Accession number, which were identified by blasting cotton fiber unigene set against GenBank Unigene database (Annotation field)
EC_ number The Enzyme Commission number (Annotation field)
ContigID The G. arboreum Cotton fiber contig ID (Cluster)
GA_ Contig_ID The G. arboreum Cotton Fiber dbEST
CLONE_ID
SPOT_ID
Element Type Type of the feature on the microarray chip, i.e. gene, buffer, control, etc.
DBid The GenBank gene database ID
Cotton12_ID The global Cotton contig ID from the most recent assembly
Swiss_Acc The SwissProt database Accession Number
Swiss_EC The SwissProt database Enzyme Commission Number
GO The Gene Ontology category
Entrez GI The GenBank GenInfo Identifier
Annotation The Functional description as deduced from blast results

Data table
ID Short Probe_ID GenBank _ProtACC Probe_Sequence GenBank_NucACC EC_ number ContigID GA_ Contig_ID CLONE_ID SPOT_ID Element Type DBid Cotton12_ID Swiss_Acc Swiss_EC GO Entrez GI Annotation
GA_10dpa_fiberEST_00002|GA__Ed0001F01f GA_10dpa_fiberEST_00002 ABJ74169 TCAGAGTTCCGTGGGAAGAGAGCACTAGTTGTGGATCCTAGATCTGTCCGGGCCAAAGTGTCAAGATATC CON_001_12938 GA__Ed0001F01f GA__Ed0001F01f gene Cotton12_35068_01 116109353 histidine kinase 1 [Medicago sativa]
GA_10dpa_fiberEST_00006|GA__Ed0003A03f GA_10dpa_fiberEST_00006 AAM19067 GGATAACCCCCGTTTCATGGTTCATACAGACCCCAAAAAACCGTTCCTAGGTTTCCGAATAAGTCAGGCT CON_001_13536 GA__Ed0003A03f GA__Ed0003A03f gene Cotton12_22991_01 P61222 NA 22074759 RNase L inhibitor-like protein [Oryza sativa (japonica cultivar-group)]
GA_10dpa_fiberEST_00008|GA__Ed0003C01f GA_10dpa_fiberEST_00008 NP_188920 AGGACATCTCATAGCAGTGAACCATTAACTGGTGCTCAGAGCTGTGGATCATTAACTGATAGTCCCCCAA GA__Ed0003C01f GA__Ed0003C01f gene Cotton12_20597_01 15228863 ice binding [Arabidopsis thaliana] unnamed protein product [Arabidopsis thaliana]
GA_10dpa_fiberEST_00009|GA__Ed0003C11f GA_10dpa_fiberEST_00009 BAC20723 CTCACAGTGTGAAAGACGGAAAGCCAGCACATCAAAGGAGCCAAAACATGCTTAGCTCTATTACCCATTC CON_001_06283 GA__Ed0003C11f GA__Ed0003C11f gene Cotton12_20335_01 23617033 xylulose kinase-like protein [Oryza sativa (japonica cultivar-group)]
GA_10dpa_fiberEST_00010|GA__Ed0003C12f GA_10dpa_fiberEST_00010 NP_566235 ATGCTGCTCACTTTTTTACCGCCACCGATTCTCGGCTTTCCAGCCTATTGATTATTGGGAGGAGAAAGGG EC 1.14.14.1 CON_001_08119 GA__Ed0003C12f GA__Ed0003C12f gene Cotton12_17155_02 18396966 unknown protein [Arabidopsis thaliana] unknown protein [Arabidopsis thaliana] AT3g04650/F7O18_13 [Arabidopsis thaliana] At3g04650/F7O18_13 [Arabidopsis thaliana]
GA_10dpa_fiberEST_00011|GA__Ed0003D05f GA_10dpa_fiberEST_00011 NP_566096 TTTACTACACCGAGAGGACATTTGCATTGGGTATGGCCTATTTTGGGCTGGGGACTGCCATTTCGGCTAT CON_001_05108 GA__Ed0003D05f GA__Ed0003D05f gene TC39073 Cotton12_08053_01 42569999 unknown protein [Arabidopsis thaliana]
GA_10dpa_fiberEST_00013|GA__Ed0003D09f GA_10dpa_fiberEST_00013 ABE81401 CGCTGGAAATGATACGCACTGGATTTAAAGAGAGCAAAGGTCTGGCGCGGTACATGGTGTTCCTAAGGCT GA__Ed0003D09f GA__Ed0003D09f gene Cotton12_21554_01 92872866 Agenet [Medicago truncatula]
GA_10dpa_fiberEST_00014|GA__Ed0003D12f GA_10dpa_fiberEST_00014 AAZ23107 GCGAATAGGCTGCTTGAAAATGATCCTCATGGTCCTAAAATCTGACCAGGGAAATTGGTTTGTCTGCAGC CON_001_11100 GA__Ed0003D12f GA__Ed0003D12f gene Cotton12_00357_01 O24381 NA 71068360 plastid ATP/ADP transport protein 2 [Manihot esculenta]
GA_10dpa_fiberEST_00015|GA__Ed0003E06f GA_10dpa_fiberEST_00015 NP_187808 TTTGCAGATTCTCGAGCTCCCATATCTGCCCCACTTCCTGTACTATTGAGGGGTTTTCAAAGGTCCGATA CON_001_06178 GA__Ed0003E06f GA__Ed0003E06f gene TC38013 Cotton12_02811_01 Q96DM3 NA 30682013 unknown protein [Arabidopsis thaliana]
GA_10dpa_fiberEST_00016|GA__Ed0003G10f GA_10dpa_fiberEST_00016 AAC25423 CAACTACGAGGAGTTCCGCGATATGATGAGAAGCGGAACCCAACACACACAACTCTTTTAGATTTTATAC EC 2.7.1.37 CON_001_12243 GA__Ed0003G10f GA__Ed0003G10f gene TC38828 Cotton12_18634_01 P49101 EC 2.7.11.1 NA 3283996 calcium-dependent protein kinase [Nicotiana tabacum]
GA_10dpa_fiberEST_00017|GA__Ed0003H02f GA_10dpa_fiberEST_00017 ABE83549 ATGAAGTTCATAAGGCGCCGAGGAGGGTGCGGTCAGGGGGGATTCATATGAGTGCTAAAGATAGGTTAGA CON_001_05505 GA__Ed0003H02f GA__Ed0003H02f gene TC40605 Cotton12_27472_01 92875619 At1g66480 [Medicago truncatula]
GA_10dpa_fiberEST_00018|GA__Ed0003H06f GA_10dpa_fiberEST_00018 NP_564708 TCGTTTAACAAGATCGAAAGGGCCCACCAGATGTATAGAGAAGGGAGGTACAACGAAGCTCTGTGTTACT GA__Ed0003H06f GA__Ed0003H06f gene Cotton12_21205_01 O35814 NA 18405682 unknown protein [Arabidopsis thaliana] unknown [Arabidopsis thaliana] At1g56090 [Arabidopsis thaliana] hypothetical protein [Arabidopsis thaliana]
GA_10dpa_fiberEST_00020|GA__Ed0004A01f GA_10dpa_fiberEST_00020 ABE90991 AGATGGCTTCCGCTCTTAATCTTCTAGATGCGGCATTGGCTCTGTCGCCCCGTTTCGAGATAGCTCTGGA EC 3.2.2.22 CON_001_05540 GA__Ed0004A01f GA__Ed0004A01f gene TC30348 Cotton12_00362_02 92891889 tetratricopeptide repeat, putative [Medicago truncatula]
GA_10dpa_fiberEST_00021|GA__Ed0004C10f GA_10dpa_fiberEST_00021 NP_173344 GCTTCTTCCATGAGAGGAGATGGGGATTGACTGCTCGGCAACATCTAAACGTCCTTTTACTCTATCAGAA EC 3.6.5.3 CON_001_10134 GA__Ed0004C10f GA__Ed0004C10f gene TC28704 Cotton12_21328_01 42562162 ATP binding [Arabidopsis thaliana] hypothetical protein [Arabidopsis thaliana]
GA_10dpa_fiberEST_00022|GA__Ed0004G03f GA_10dpa_fiberEST_00022 NP_201248 CAAGTGGTGTCGCGGCGCTGAATCACGACAGATAAGGTTGCCGAGAATGCTAAGGCTCCACCGCAAACTT CON_001_08377 GA__Ed0004G03f GA__Ed0004G03f gene TC39777 Cotton12_18262_01 15237703 unknown protein [Arabidopsis thaliana] unnamed protein product [Arabidopsis thaliana] Unknown protein [Arabidopsis thaliana] unknown protein [Arabidopsis thaliana] unknown protein [Arabidopsis thaliana] At5g64430 [Arabidopsis thaliana]
GA_10dpa_fiberEST_00023|GA__Ed0004H08f GA_10dpa_fiberEST_00023 ABE92875 AATCCTCCGGTGTGTGCGTGTGTGTTGTTTGGGTAAAAAGGCAACACAAGAAGTTATTTCACAAGTTCCT EC 1.2.1.27 CON_001_05253 GA__Ed0004H08f GA__Ed0004H08f gene Cotton12_20163_01 Q0WM29 EC 1.2.1.27 GO:0004491 92895867 Aldehyde dehydrogenase [Medicago truncatula]
GA_10dpa_fiberEST_00025|GA__Ed0005A12f GA_10dpa_fiberEST_00025 NP_191142 TGTTAAGTCTACTCGCAATCGCGAACCGAAACCGCGACAGTTCTTCGTTTATGGGATGGACCGGTGACTT CON_001_08460 GA__Ed0005A12f GA__Ed0005A12f gene TC33015 Cotton12_38492_01 15228749 EPC1 (ECTOPICALLY PARTING CELLS); transferase, transferring glycosyl groups [Arabidopsis thaliana] putative protein [Arabidopsis thaliana] hypothetical protein [Arabidopsis thaliana]
GA_10dpa_fiberEST_00027|GA__Ed0005D03f GA_10dpa_fiberEST_00027 ABE91354 AAGTCTCCGCCGTCATTTCAAGCGTCGCTGACGTAGCTGATAGTAACGAAATCTCCAAAGACGACGCTGT CON_001_05912 GA__Ed0005D03f GA__Ed0005D03f gene TC34421 Cotton12_02977_02 92892675 Lissencephaly type-1-like homology motif; CTLH, C-terminal to LisH motif [Medicago truncatula]
GA_10dpa_fiberEST_00028|GA__Ed0005E01f GA_10dpa_fiberEST_00028 AAO52746 ATAGGTGGATTTGATGCACCACATGCAGCTGCACGAGCATATGATAGAGCAGCTATAAAGTTCCGGGGAG CON_001_11250 GA__Ed0005E01f GA__Ed0005E01f gene Cotton12_27534_01 P47927 NA 28894443 LIPLESS1 [Antirrhinum majus]
GA_10dpa_fiberEST_00029|GA__Ed0005E02f GA_10dpa_fiberEST_00029 TTTTTGTCCTAAAACTTCTCTTCCAACAACTCAACCCTAGCTTTGCTGGAGCTAGCTAAATGGAGATGTG CON_001_06788 GA__Ed0005E02f GA__Ed0005E02f gene Cotton12_35397_01

Total number of rows: 12311

Table truncated, full table size 3630 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap