^PLATFORM = Murine 15K long oligo array version 2.0 !Platform_title = Murine 15K long oligo array version 2.0 !Platform_technology = spotted oligonucleotide !Platform_distribution = non-commercial !Platform_organism = Mus musculus !Platform_manufacturer = Un. London microarray facility !Platform_manufacture_protocol = 1. Oligos are arrayed in Greiner 384-well flat-bottom plates. Each well contains 600 pmol of 70-mer oligo. !Platform_manufacture_protocol = 2. Resuspend oligos in water to 20 uM and rearray 5 無 into 384-well, Genetix polystyrene V-bottom plates (cat# X6004). !Platform_manufacture_protocol = 3. Allow Genetix plates to dry through passive water evaporation in a protected environment (e.g., chemical hood). !Platform_manufacture_protocol = 4. Before printing, add 5 無 of 1X Printing Buffer to each well. This can be done the night before a print run is started. !Platform_manufacture_protocol = 5. Seal plates with Corning seals. !Platform_manufacture_protocol = 6. Incubate at 37蚓 for 30 minutes to aid resuspension of DNA. !Platform_manufacture_protocol = 7. Shake plates near maximum rotational speed on flat-bed shaker for 1 minute. !Platform_manufacture_protocol = 8. Centrifuge plates at 2000 rpm for 3 minutes. !Platform_manufacture_protocol = 9. Remove seals and cover with plate lids. Place in appropriate location of plate cassette. This should be done with first plates just before print run is started to minimize evaporation time before printing. For second and third cassettes, wait until 30 minutes before next cassette is needed to begin centrifugation. !Platform_manufacture_protocol = 10. Make sure plates rest behind both holding clips in the cassettes. Push plates back into the cassettes as far as they will go, putting them in the proper position for the server arm. !Platform_manufacture_protocol = 11. After the print run is completed, allow plates to dry through passive evaporation in a protected environment. !Platform_manufacture_protocol = 12. For each subsequent preparation of these plates for a print run, add water to the wells instead of sodium phosphate buffer. The amount of water should be decreased by 0.25 無 per print run, as this is the amount drawn up by the pin capillary during each dip. !Platform_support = glass !Platform_coating = polysine !Platform_web_link = http://www.microarray.protocols.html !Platform_contributor = Jane,Doe !Platform_contributor = John,A,Smith !Platform_contributor = Hans,van Elton !Platform_contributor = John,Smithers Jr !Platform_contributor = Jie,D,Chen #ID = #GB_ACC = GenBank accession number of sequence used to design oligonucleotide probe LINK_PRE:"http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Search&db=Nucleotide&term=" #Gene_Desc = Gene description #Gene_Sym = Gene symbols #SEQUENCE = Probe sequence information #SPOT_ID = alternative identifier !platform_table_begin ID GB_ACC Gene_Desc Gene_Sym SPOT_ID SEQUENCE 1 U02079 nuclear factor of activated T-cells, cytoplasmic 2 Nfatc2 ACCTGGATGACGCAGCCACTTCAGAAAGCTGGGTTGGGACAGAAAGGTATATAGAGAGAAAATTTTGGAA 2 NM_008154 G-protein coupled receptor 3 Gpr3 CTGTACAATGCTCTCACTTACTACTCAGAGACAACGGTAACTCGGACTTATGTGATGCTGGCCTTGGTGT 3 AK015719 tropomodulin 2 Tmod2 CACCAGGCTCAGTGCCTAGTATCGGCTTCACCTAGTGTGGTTACTCAGGGCACGCAGAGCTACAGAACAC 4 AK003367 mitochondrial ribosomal protein L15 Mrpl15 CAAGAAGTCTAGAAATTCTGTGCAAGCCTATTCCATTCTTTCTGCGGGGACAACCAATTCCGAAAAGAAT 5 BC003333 RIKEN cDNA 0610033I05 gene 0610033I05Rik AGAACTGGGTGGCAGATATCCTAGAGTTTTGACCAACGTTCACAGCACACATATTGATCTTATAGGACCT 6 NM_008462 killer cell lectin-like receptor, subfamily A, member 2 Klra2 TGAATTGAAGTTCCTTAAATCCCAACTTCAAAGAAACACATACTGGATTTCACTGACACATCATAAAAGC 7 NM_008029 FMS-like tyrosine kinase 4 Flt4 GAGGTGCTGTGGGATGACCGCCGGGGCATGCGGGTGCCCACTCAACTGTTGCGCGATGCCCTGTACCTGC 8 NM_054088 adiponutrin Adpn GTCTGAGTTCCATTCCAAAGACGAAGTCGTGGATGCCCTGGTGTGTTCCTGCTTCATTCCCCTCTTCTCT 9 NM_009750 nerve growth factor receptor (TNFRSF16) associated protein 1 Ngfrap1 TACAGCTGAGAAATTGTCTACGCATCCTTATGGGGGAGCTGTCTAACCACCACGATCACCATGATGAATT 10 AB045323 DNA segment, Chr 8, ERATO Doi 594, expressed D8Ertd594e GATTCAGACTCGGGAGGAGCATCCCAACCTCTCCTTGAGGATAAAGGCCTGAGCGATTGCCCTGGGGAGC 11 AK005789 dynein, cytoplasmic, light chain 2B Dncl2b TGCAGAAGGCATTCCAATCCGAACAACCCTGGACAACTCCACAACGGTTCAGTATGCGGGTCTTCTCCAC 12 NM_010517 insulin-like growth factor binding protein 4 Igfbp4 GGAGAAGCTGGCGCGCTGCCGCCCCCCCGTGGGTTGCGAGGAGTTGGTGCGGGAGCCAGGCTGCGGTTGT 13 AK010722 RIKEN cDNA 2410075D05 gene 2410075D05Rik GGAGCATCTGGAGTTCCGCTTACCGGAAATAAAGTCTTTACTATCGGTGATTGGAGGGCAGTTCACTAAC 14 AK003755 DNA segment, Chr 4, ERATO Doi 421, expressed D4Ertd421e AGCAAAGAGATCTCCCTCAGTGTGCCCATAGGTGGCGGTGCGAGCTTGCGGTTATTGGCCAGTGACTTGC 15 BC003241 cleavage stimulation factor, 3' pre-RNA, subunit 3 Cstf3 AAATTAGAAGAAAATCCATATGACCTTGATGCTTGGAGCATTCTCATTCGAGAGGCACAGAATCAACCTA 16 AK004937 RIKEN cDNA 1300007O09 gene 1300007O09Rik CAGACACAAACCCTAGGTTGTATTGTAGACCGGAGTTTAAGCAGGCACTACCTGTCTGTCTTTTCTTCAT 17 AK004524 unnamed protein product; hypothetical SOCS domain CGGAGCCCTGCGCGCCCAGAGCCCCCTCCCACCCGCTTCCACCAAGTGCATGGAGCCAACATCCGCATGG 18 NM_025999 RIKEN cDNA 2610110L04 gene 2610110L04Rik TGCATTGATAAATGGAGTGATCGACACAGGAACTGCCCCATTTGTCGCCTACAGATGACTGGAGCAAATG 19 -- CONTROL 20 NM_023120 guanine nucleotide binding protein (G protein), beta polypeptide 1-like Gnb1l ACCGCCTGGTCCCAGATTTGTCCTCCGAGGCACACAGTCGGCTGTGAACACGCTCCATTTCTGCCCACCA !platform_table_end ^SAMPLE = Control Embyronic Stem Cell Replicate 1 !Sample_title = Control Embyronic Stem Cell Replicate 1 !Sample_supplementary_file = file1.gpr !Sample_source_name_ch1 = Total RNA from murine ES-D3 embryonic stem cells labeled with Cyanine-5 (red). !Sample_organism_ch1 = Mus musculus !Sample_characteristics_ch1 = Cell line: ES-D3 (CRL-1934) !Sample_characteristics_ch1 = Passages: 4 !Sample_characteristics_ch1 = Cell type: embryonic stem cells derived from blastocysts !Sample_characteristics_ch1 = Strain: 129Sv !Sample_growth_protocol_ch1 = ES cells were kept in an undifferentiated, pluripotent state by using 1000 IU/ml leukemia inhibitory factor (LIF; Chemicon, ESGRO, ESG1107), and grown on top of murine embryonic fibroblasts feeder layer inactivated by 10 ug/ml of mitomycin C (Sigma, St. Louis). ES cells were cultured on 0.1% gelatin-coated plastic dishes in ES medium containing Dulbecco modified Eagle medium supplemented with 15% fetal calf serum, 0.1 mM beta-mercaptoethanol, 2 mM glutamine, and 0.1 mN non-essential amino acids. !Sample_extract_protocol_ch1 = TriZol procedure !Sample_molecule_ch1 = total RNA !Sample_label_ch1 = Cy5 !Sample_label_protocol_ch1 = 10 痢 of total RNA were primed with 2 痞 of 100 然 T16N2 DNA primer at 70蚓 for 10 min, then reversed transcribed at 42蚓 for 1 h in the presence of 400 U SuperScript II RTase (Invitrogen), and 100 然 each dATP, dTTP, dGTP, with 25 然 dCTP, 25 然 Cy5-labeled dCTP (NEN Life Science, Boston, MA), and RNase inhibitor (Invitrogen). RNA was then degraded with RNase A, and labeled cDNAs were purified using QIAquick PCR columns (Qiagen). !Sample_source_name_ch2 = Total RNA from pooled whole mouse embryos e17.5, labeled with Cyanine-3 (green). !Sample_organism_ch2 = Mus musculus !Sample_characteristics_ch2 = Strain: C57BL/6 !Sample_characteristics_ch2 = Age: E17.5 d !Sample_characteristics_ch2 = Tissue: whole embryo !Sample_extract_protocol_ch2 = TriZol procedure !Sample_molecule_ch2 = total RNA !Sample_label_ch2 = Cy3 !Sample_label_protocol_ch2 = 10 痢 of total RNA were primed with 2 痞 of 100 然 T16N2 DNA primer at 70蚓 for 10 min, then reversed transcribed at 42蚓 for 1 h in the presence of 400 U SuperScript II RTase (Invitrogen), and 100 然 each dATP, dTTP, dGTP, with 25 然 dCTP, 25 然 Cy5-labeled dCTP (NEN Life Science, Boston, MA), and RNase inhibitor (Invitrogen). RNA was then degraded with RNase A, and labeled cDNAs were purified using QIAquick PCR columns (Qiagen). !Sample_hyb_protocol = Oligoarray control targets and hybridization buffer (Agilent In Situ Hybridization Kit Plus) were added, and samples were applied to microarrays enclosed in Agilent SureHyb-enabled hybridization chambers. After hybridization, slides were washed sequentially with 6x SSC/0.005% Triton X-102 and 0.1x SSC/0.005% Triton X-102 before scanning. Slides were hybridized for 17 h at 60蚓 in a rotating oven, and washed. !Sample_scan_protocol = Scanned on an Agilent G2565AA scanner. !Sample_scan_protocol = Images were quantified using Agilent Feature Extraction Software (version A.7.5). !Sample_description = Biological replicate 1 of 4. Control embryonic stem cells, untreated, harvested after several passages. !Sample_data_processing = LOWESS normalized, background subtracted VALUE data obtained from log of processed Red signal/processed Green signal. !Sample_platform_id = Murine 15K long oligo array version 2.0 #ID_REF = #VALUE = log2(REDsignal/GREENsignal) per feature (processed signals used). #LogRatioError = error of the log ratio calculated according to the error model chosen. #PValueLogRatio = Significance level of the Log Ratio computed for a feature. #gProcessedSignal = Dye-normalized signal after surrogate "algorithm," green "channel," used for computation of log ratio. #rProcessedSignal = Dye-normalized signal after surrogate "algorithm," red "channel," used for computation of log ratio. !sample_table_begin ID_REF VALUE LogRatioError PValueLogRatio gProcessedSignal rProcessedSignal 1 -1.6274758 1.36E-01 6.41E-33 9.13E+03 2.15E+02 2 0.1412248 1.34E+00 1.00E+00 4.14E+01 5.72E+01 3 0.1827684 5.19E-02 4.33E-04 5.13E+03 7.81E+03 4 -0.3932267 6.08E-02 1.02E-10 4.65E+03 1.88E+03 5 -0.9865994 1.05E-01 6.32E-21 2.91E+03 3.01E+02 6 0.0238812 1.02E-01 8.15E-01 7.08E+02 7.48E+02 7 -1.4841822 1.25E-01 1.42E-32 1.02E+04 3.36E+02 8 -1.8261356 4.15E-01 1.10E-05 7.19E+02 1.07E+01 9 -1.0344779 1.78E+00 1.00E+00 9.62E+01 8.89E+00 10 0.2405891 3.09E-01 4.36E-01 1.61E+02 2.80E+02 11 0.3209366 3.59E-01 3.71E-01 1.25E+02 2.61E+02 12 0.358304 2.06E+00 1.00E+00 2.04E+01 4.66E+01 13 -0.0122072 3.64E-01 9.73E-01 1.84E+02 1.79E+02 14 -1.5480396 1.30E-01 7.21E-33 1.02E+04 2.90E+02 15 0.0073419 2.98E-01 9.80E-01 2.21E+02 2.25E+02 16 -0.2267015 9.44E-01 8.10E-01 8.90E+01 5.28E+01 17 -0.1484023 8.01E-01 8.53E-01 9.65E+01 6.86E+01 18 -0.6122195 1.28E-01 1.69E-06 1.12E+03 2.73E+02 19 0.0796905 8.78E-02 3.64E-01 8.21E+02 9.87E+02 20 -0.084895 9.38E-01 9.28E-01 7.68E+01 6.32E+01 !sample_table_end ^SAMPLE = Control Embyronic Stem Cell Replicate 2 !Sample_title = Control Embyronic Stem Cell Replicate 2 !Sample_supplementary_file = file2.gpr !Sample_source_name_ch1 = Total RNA from murine ES-D3 embryonic stem cells labeled with Cyanine-5 (red). !Sample_organism_ch1 = Mus musculus !Sample_characteristics_ch1 = Cell line: ES-D3 (CRL-1934) !Sample_characteristics_ch1 = Passages: 4 !Sample_characteristics_ch1 = Cell type: embryonic stem cells derived from blastocysts !Sample_characteristics_ch1 = Strain: 129Sv !Sample_growth_protocol_ch1 = ES cells were kept in an undifferentiated, pluripotent state by using 1000 IU/ml leukemia inhibitory factor (LIF; Chemicon, ESGRO, ESG1107), and grown on top of murine embryonic fibroblasts feeder layer inactivated by 10 ug/ml of mitomycin C (Sigma, St. Louis). ES cells were cultured on 0.1% gelatin-coated plastic dishes in ES medium containing Dulbecco modified Eagle medium supplemented with 15% fetal calf serum, 0.1 mM beta-mercaptoethanol, 2 mM glutamine, and 0.1 mN non-essential amino acids. !Sample_extract_protocol_ch1 = TriZol procedure !Sample_molecule_ch1 = total RNA !Sample_label_ch1 = Cy5 !Sample_label_protocol_ch1 = 10 痢 of total RNA were primed with 2 痞 of 100 然 T16N2 DNA primer at 70蚓 for 10 min, then reversed transcribed at 42蚓 for 1 h in the presence of 400 U SuperScript II RTase (Invitrogen), and 100 然 each dATP, dTTP, dGTP, with 25 然 dCTP, 25 然 Cy5-labeled dCTP (NEN Life Science, Boston, MA), and RNase inhibitor (Invitrogen). RNA was then degraded with RNase A, and labeled cDNAs were purified using QIAquick PCR columns (Qiagen). !Sample_source_name_ch2 = Total RNA from pooled whole mouse embryos e17.5, labeled with Cyanine-3 (green). !Sample_organism_ch2 = Mus musculus !Sample_characteristics_ch2 = Strain: C57BL/6 !Sample_characteristics_ch2 = Age: E17.5 d !Sample_characteristics_ch2 = Tissue: whole embryo !Sample_extract_protocol_ch2 = TriZol procedure !Sample_molecule_ch2 = total RNA !Sample_label_ch2 = Cy3 !Sample_label_protocol_ch2 = 10 痢 of total RNA were primed with 2 痞 of 100 然 T16N2 DNA primer at 70蚓 for 10 min, then reversed transcribed at 42蚓 for 1 h in the presence of 400 U SuperScript II RTase (Invitrogen), and 100 然 each dATP, dTTP, dGTP, with 25 然 dCTP, 25 然 Cy5-labeled dCTP (NEN Life Science, Boston, MA), and RNase inhibitor (Invitrogen). RNA was then degraded with RNase A, and labeled cDNAs were purified using QIAquick PCR columns (Qiagen). !Sample_hyb_protocol = Oligoarray control targets and hybridization buffer (Agilent In Situ Hybridization Kit Plus) were added, and samples were applied to microarrays enclosed in Agilent SureHyb-enabled hybridization chambers. After hybridization, slides were washed sequentially with 6x SSC/0.005% Triton X-102 and 0.1x SSC/0.005% Triton X-102 before scanning. Slides were hybridized for 17 h at 60蚓 in a rotating oven, and washed. !Sample_scan_protocol = Scanned on an Agilent G2565AA scanner. !Sample_scan_protocol = Images were quantified using Agilent Feature Extraction Software (version A.7.5). !Sample_description = Biological replicate 2 of 4. Control embryonic stem cells, untreated, harvested after several passages. !Sample_data_processing = LOWESS normalized, background subtracted VALUE data obtained from log of processed Red signal/processed Green signal. !Sample_platform_id = Murine 15K long oligo array version 2.0 #ID_REF = #VALUE = log2(REDsignal/GREENsignal) per feature (processed signals used). #LogRatioError = error of the log ratio calculated according to the error model chosen. #PValueLogRatio = Significance level of the Log Ratio computed for a feature. #gProcessedSignal = Dye-normalized signal after surrogate "algorithm," green "channel," used for computation of log ratio. #rProcessedSignal = Dye-normalized signal after surrogate "algorithm," red "channel," used for computation of log ratio. !sample_table_begin ID_REF VALUE LogRatioError PValueLogRatio gProcessedSignal rProcessedSignal 1 -1.1697263 1.23E-01 2.14E-21 3.17E+03 2.14E+02 2 -0.1111353 1.63E+00 9.46E-01 5.43E+01 4.20E+01 3 0.1400597 5.11E-02 6.17E-03 6.72E+03 9.28E+03 4 -0.4820633 6.38E-02 4.06E-14 6.46E+03 2.13E+03 5 -1.2116196 1.22E-01 2.31E-23 3.62E+03 2.22E+02 6 -0.0230528 1.04E-01 8.24E-01 8.76E+02 8.31E+02 7 -1.1380152 1.13E-01 9.23E-24 3.94E+03 2.86E+02 8 -1.834596 5.40E-01 6.74E-04 6.44E+02 9.43E+00 9 -0.9747637 2.14E+00 1.00E+00 9.17E+01 9.72E+00 10 0.3874005 2.92E-01 1.85E-01 1.69E+02 4.11E+02 11 0.5340442 3.29E-01 1.04E-01 1.23E+02 4.20E+02 12 0.3260696 1.92E+00 8.65E-01 2.73E+01 5.77E+01 13 0.3010618 2.84E-01 2.90E-01 1.93E+02 3.87E+02 14 -1.0760413 1.08E-01 1.63E-23 4.06E+03 3.41E+02 15 -0.1167371 3.87E-01 7.63E-01 2.32E+02 1.77E+02 16 -0.1936322 9.44E-01 8.38E-01 1.02E+02 6.56E+01 17 -0.3275898 7.87E-01 6.77E-01 1.41E+02 6.65E+01 18 -0.4805853 1.14E-01 2.41E-05 1.34E+03 4.42E+02 19 0.1109524 9.56E-02 2.46E-01 8.38E+02 1.08E+03 20 0.1677912 6.51E-01 7.97E-01 9.84E+01 1.45E+02 !sample_table_end ^SAMPLE = Triple-Fusion Transfected Embryonic Stem Cells Replicate 1 !Sample_supplementary_file = file3.gpr !Sample_title = Triple-Fusion Transfected Embryonic Stem Cells Replicate 1 !Sample_source_name_ch1 = Total RNA from murine ES-D3 triple-transfected embryonic stem cells labeled with Cyanine-5 (red). !Sample_organism_ch1 = Mus musculus !Sample_characteristics_ch1 = Cell line: ES-D3 (CRL-1934) transfected with pUb-fluc-mrfp-ttk triple fusion reporter gene !Sample_characteristics_ch1 = Passages: 4 !Sample_characteristics_ch1 = Cell type: embryonic stem cells derived from blastocysts !Sample_characteristics_ch1 = Strain: 129Sv !Sample_treatment_protocol_ch1 = PCR amplification and standard cloning techniques were used to insert fluc and mrfp genes from plasmids pCDNA 3.1-CMV-fluc (Promega, Madison, WI) and pCDNA3.1-CMV-mrfp in frame with the ttk gene into the pCDNA3.1-truncated sr39tk. This triple fusion (TF) reporter gene fragment (3.3 kbp) was released from the plasmid with Not1 and BamH1 restriction enzymes before blunt-end ligation into the multiple cloning site of lentiviral transfer vector, FUG, driven by the human ubiquitin-C promoter. Self-inactivating (SIN) lentivirus was prepared by transient transfection of 293T cells. Briefly, pFUG-TF containing the triple fusion reporter gene was co-transfected into 293T cells with HIV-1 packaging vector (8.9) and vesicular stomatitis virus G glycoprotein-pseudotyped envelop vector (pVSVG). Lentivirus supernatant was concentrated by sediment centrifugation using a SW29 rotor at 50,000 x g for two hours. Concentrated virus was titered on 293T cells. Murine ES cells were transfected with LV-pUb-fluc-mrfp-ttk at a multiplicity of infection (MOI) of 10. !Sample_growth_protocol_ch1 = ES cells were kept in an undifferentiated, pluripotent state by using 1000 IU/ml leukemia inhibitory factor (LIF; Chemicon, ESGRO, ESG1107), and grown on top of murine embryonic fibroblasts feeder layer inactivated by 10 ug/ml of mitomycin C (Sigma, St. Louis). ES cells were cultured on 0.1% gelatin-coated plastic dishes in ES medium containing Dulbecco modified Eagle medium supplemented with 15% fetal calf serum, 0.1 mM beta-mercaptoethanol, 2 mM glutamine, and 0.1 mN non-essential amino acids. !Sample_extract_protocol_ch1 = TriZol procedure !Sample_molecule_ch1 = total RNA !Sample_label_ch1 = Cy5 !Sample_label_protocol_ch1 = 10 痢 of total RNA were primed with 2 痞 of 100 然 T16N2 DNA primer at 70蚓 for 10 min, then reversed transcribed at 42蚓 for 1 h in the presence of 400 U SuperScript II RTase (Invitrogen), and 100 然 each dATP, dTTP, dGTP with 25 然 dCTP, 25 然 Cy5-labeled dCTP (NEN Life Science, Boston, MA), and RNase inhibitor (Invitrogen). RNA was then degraded with RNase A, and labeled cDNAs were purified using QIAquick PCR columns (Qiagen). !Sample_source_name_ch2 = Total RNA from pooled whole mouse embryos e17.5, labeled with Cyanine-3 (green). !Sample_organism_ch2 = Mus musculus !Sample_characteristics_ch2 = Strain: C57BL/6 !Sample_characteristics_ch2 = Age: E17.5 d !Sample_characteristics_ch2 = Tissue: whole embryo !Sample_extract_protocol_ch2 = TriZol procedure !Sample_molecule_ch2 = total RNA !Sample_label_ch2 = Cy3 !Sample_label_protocol_ch2 = 10 痢 of total RNA were primed with 2 痞 of 100 然 T16N2 DNA primer at 70蚓 for 10 min, then reversed transcribed at 42蚓 for 1 h in the presence of 400 U SuperScript II RTase (Invitrogen), and 100 然 each dATP, dTTP, dGTP, with 25 然 dCTP, 25 然 Cy5-labeled dCTP (NEN Life Science, Boston, MA), and RNase inhibitor (Invitrogen). RNA was then degraded with RNase A, and labeled cDNAs were purified using QIAquick PCR columns (Qiagen). !Sample_hyb_protocol = Oligoarray control targets and hybridization buffer (Agilent In Situ Hybridization Kit Plus) were added, and samples were applied to microarrays enclosed in Agilent SureHyb-enabled hybridization chambers. After hybridization, slides were washed sequentially with 6x SSC/0.005% Triton X-102 and 0.1x SSC/0.005% Triton X-102 before scanning. Slides were hybridized for 17 h at 60蚓 in a rotating oven, and washed. !Sample_scan_protocol = Scanned on an Agilent G2565AA scanner. !Sample_description = Biological replicate 1 of 3. Stable triple-fusion-reporter-gene transfected embryonic stem cells, harvested after several passages. !Sample_data_processing = LOWESS normalized, background subtracted VALUE data obtained from log of processed Red signal/processed Green signal. !Sample_platform_id = Murine 15K long oligo array version 2.0 #ID_REF = #VALUE = log2(REDsignal/GREENsignal) per feature (processed signals used). #LogRatioError = error of the log ratio calculated according to the error model chosen. #PValueLogRatio = Significance level of the Log Ratio computed for a feature. #gProcessedSignal = Dye-normalized signal after surrogate "algorithm," green "channel," used for computation of log ratio. #rProcessedSignal = Dye-normalized signal after surrogate "algorithm," red "channel," used for computation of log ratio. !sample_table_begin ID_REF VALUE LogRatioError PValueLogRatio gProcessedSignal rProcessedSignal 1 -0.7837546 1.30E-01 1.70E-09 2.10E+03 3.46E+02 2 0.3797837 1.15E+00 7.41E-01 5.59E+01 1.34E+02 3 0.2079269 5.38E-02 1.12E-04 5.04E+03 8.14E+03 4 -0.4730291 6.71E-02 1.86E-12 5.66E+03 1.91E+03 5 -0.9481128 1.19E-01 1.30E-15 3.10E+03 3.49E+02 6 -0.0159867 1.33E-01 9.05E-01 8.45E+02 8.14E+02 7 -0.819922 1.14E-01 7.01E-13 2.75E+03 4.16E+02 8 -0.1559774 9.16E-01 8.65E-01 1.34E+02 9.34E+01 9 0.145267 3.90E+00 1.00E+00 2.22E+01 3.10E+01 10 0.3611211 3.40E-01 2.88E-01 1.97E+02 4.52E+02 11 0.5092089 4.39E-01 2.46E-01 1.24E+02 4.01E+02 12 0.3715387 1.69E+00 8.26E-01 3.84E+01 9.04E+01 13 0.1734934 3.57E-01 6.27E-01 2.37E+02 3.53E+02 14 -0.9340707 1.20E-01 6.90E-15 2.96E+03 3.45E+02 15 -0.2956317 5.78E-01 6.09E-01 2.46E+02 1.25E+02 16 -0.2321102 1.22E+00 8.49E-01 1.09E+02 6.37E+01 17 -0.1603561 1.16E+00 8.90E-01 1.06E+02 7.34E+01 18 -0.5063897 1.63E-01 1.95E-03 1.15E+03 3.58E+02 19 0.1990761 1.32E-01 1.32E-01 6.65E+02 1.05E+03 20 0.2985912 8.89E-01 7.37E-01 8.06E+01 1.60E+02 !sample_table_end ^SERIES = Murine ES Cells !Series_title = Murine ES Cells: Control vs. Triple-Fusion Transfected !Series_pubmed_id = 16390873 !Series_summary = Transcriptional profiling of mouse embryonic stem cells comparing control untreated ES cells with ES cells transfected with a pUb-fluc-mrfp-ttk triple fusion reporter gene. The latter makes ES visualization possible by FACS and single ce !Series_overall_design = Two-condition experiment, ES vs. TF-ES cells. Biological replicates: 4 control, 3 transfected, independently grown and harvested. One replicate per array. !Series_contributor = Joseph,C,Wu !Series_contributor = Joshua,M,Spin !Series_contributor = Feng,,Cao !Series_contributor = Shaun,,Lin !Series_contributor = Olivier,,Gheysens !Series_contributor = Ian,Y,Chen !Series_contributor = Anya,,Tsalenko !Series_contributor = Sanjiv,S,Ghambhir !Series_contributor = Thomas,,Quertermous !Series_sample_id = Control Embyronic Stem Cell Replicate 1 !Series_sample_id = Control Embyronic Stem Cell Replicate 2 !Series_sample_id = Triple-Fusion Transfected Embryonic Stem Cells Replicate 1