Flu home Database Genome Set Alignment Tree BLAST Annotation FTP Help Contact us
Influenza Virus Resource presents data obtained from the NIAID Influenza Genome Sequencing Project as well as from GenBank, combined with tools for flu sequence analysis, annotation and submission to GenBank. In addition, it provides links to other resources that contain flu sequences, publications and general information about flu viruses.

Read more about: This resource | Flu database | Flu sequence submission to GenBank | NIAID Influenza Sequencing Project | Influenza virus biology
toggle on/off NCBI
toggle on/offFlu resources
toggle on/offNCBI Viruses
toggle on/offCollaborators
Submitting Influenza Virus Sequences to GenBank

If you are familiar with GenBank sequence submission tools such as Sequin, BankIt or tbl2asn, you can continue using these tools.

A streamlined GenBank submission pipeline for the submission of Influenza virus sequences has been established. To use this pipeline, just follow the three simple steps:

1. Prepare a table (in tab-delimited or Microsoft Excel format) containing sample information as shown below. For a template, you can:
Download an Excel file, or
Download a tab-delimited text file.

Instructions for making the table:
A. Headers of the table should be exactly the same as those in the example for existing fields.
B. "Blinded Number" should be unique for each virus (and with an institution-specific prefix is highly recommended). Avoid using symbols other than letters, numbers or dashes. Please note that the Blinded Numbers in this table are used to identify virus isolates only, and they should not contain segment information. Therefore, you should only have one row for each virus isolate in this table, even when you are submitting more than one segment of the virus. Segments are identified in the sequence file discussed in #2 below.
C. Organism name should follow influenza naming convention (A/non-human host/location/isolate number/year in four digits(subtype)).
D. Use only GenBank standard country names in the "Country" field (e.g. United Kingdom, not England).
E. Collection date should be in the format of DD-Mmm-YYYY (e.g. 03-Jul-2009).
F. Use lower cases for "Host" names, except for proper names (e.g. American wigeon).
G. Additional source information can be included in a "Notes" column at the end of the table for inclusion in GenBank.

2. Prepare all nucleotide sequences in one FASTA file, as shown in an example below. You can also download the example file.

>WIV-123456.4
GATCAGATTTGCATTGGTTACCATGCAAACAATTCAACAGAGCAGGTTGACACAATCATG
GAAAAGAACGTTACTGTTACACATGCCCAAGACATACTGGAAAAGACACACAACGGGAAG
CTCTGCGATCTAGATGGAGTGAAGCCTCTAATTTTAAGAGATTGTAGTGTAGCTGGATGG
...
>WIV-123456.7
AGCAAAAGCAGGTAGATATTGAAAGATGAGTCTTCTAACCGAGGTCGAAACGTACGTTCT
CTCTATCATCCCGTCAGGCCCCCTCAAAGCCGAGATCGCGCAGAAACTTGAAGATGTTTT
...
>CDC07726225.6
AGCAAAAGCAGGAGATTAAAATGAATCCAAATCAGAAGATAATAACCATTGGATCAATCT
...

The definition line of each sequence should only contain the corresponding Blinded Number followed by a suffix of the segment number (e.g. >CDC07726225.6 for segment 6 of sample CDC07726225).

Validate your sequences using the NCBI Influenza Genome Annotation Tool, verify all "ERROR"s reported in the result page and make corrections in the sequences if necessary.

3. Send the table and sequence files in an email to: genomes@ncbi.nlm.nih.gov. A list of authors, contact information (affiliation, address, phone and fax numbers) and a brief description of the sequences (or the title of a manuscript) should also be provided in the email.

After receiving these data, NCBI staff will start the GenBank submission process and communicate with submitters if there are any issues with the submission.

Contact us if you have any questions.

|Disclaimer |Privacy statement | Accessibility |
NCBI Home NCBI Search NCBI SiteMap