ncbi logo		 UniSTS logo
 PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure
  Search for

Entrez UniSTS
Help
Query tips
Submit
Submit map
FTP site
Statistics

Related sites
e-PCR
Map Viewer
Gene
UniGene
dbSNP
GeneMap'99
MGD
ZFIN

Genomic biology
Bos taurus
Canis familiaris
Danio rerio
Homo sapiens
Mus musculus
Rattus novegicus
Sus scrofa

UniSTS:96258 Links
RH101923
Canis familiaris chromosome 7, locus CAMSAP1L1
Equus caballus chromosome 30, locus LOC100062957
Homo sapiens chromosome 1, locus CAMSAP1L1
Macaca mulatta chromosome 1, locus LOC709092
Pan troglodytes chromosome 1, locus CAMSAP1L1

Found by e-PCR in sequences from Canis lupus, Equus caballus, Felis catus, Homo sapiens, Macaca mulatta, Pan troglodytes, Pongo abelii and Tupaia belangeri.

Primer InformationHelp

Forward primer:TCTGCACTCCAAAATACTGTGG
Reverse primer:TTTGCACTTCATCTTTCCTGC
PCR product size:132 (bp), Homo sapiens

   Canis familiaris
Name: RH101923
Polymorphism info:  

Cross References Help
Gene GeneID:490247
 Symbol:CAMSAP1L1
 Description:calmodulin regulated spectrin-associated protein 1-like 1
 Position: 

Mapping InformationHelp
RH101923 Sequence Map: Chr 7 Map Viewer
  Position: 5276922-5277053 (bp)

   Canis lupus
 
Polymorphism info:  

Electronic PCR results Help
RefSeq mRNA (1)
XM_547368.2 4524 .. 4655 (132 bp)  
 
Genomic RefSeqs (1)
NW_876323.1 396803 .. 396934 (132 bp)  
 
Genomic (1)
AC183636.2 182537 .. 182668 (132 bp)  
 
Working Draft phase 1 (from GenBank HTGS division) (1)
AC190117.2 204036 .. 204167 (132 bp)  
 
ESTs (1)
BI397439.1 263 .. 393 (131 bp)  
 
Whole Genome Shotgun sequences (2)
AACN010419476.1 514 .. 645 (132 bp)  
AAEX02025858.1 7792 .. 7923 (132 bp)  
 

   Equus caballus
Name: RH101923
Polymorphism info:  

Cross References Help
Gene GeneID:100062957
 Symbol:LOC100062957
 Description:similar to calmodulin regulated spectrin-associated protein 1-like 1
 Position: 

Mapping InformationHelp
RH101923 Sequence Map: Chr 30 Map Viewer
  Position: 27992090-27992220 (bp)

Electronic PCR results Help
Genomic RefSeqs (1)
NW_001867407.1 18558866 .. 18558996 (131 bp)  
 
Whole Genome Shotgun sequences (1)
AAWR02033686.1 69572 .. 69702 (131 bp)  
 

   Felis catus
 
Polymorphism info:  

Electronic PCR results Help
Whole Genome Shotgun sequences (2)
AANG01029213.1 1692 .. 1823 (132 bp)  
ACBE01573308.1 8979 .. 9110 (132 bp)  
 

   Homo sapiens
Name: RH101923
Also known as: stSG51720
Polymorphism info:  

Cross References Help
Gene GeneID:23271
 Symbol:CAMSAP1L1
 Description:calmodulin regulated spectrin-associated protein 1-like 1
 Position:1q32.1
UniGeneHs.23585 Calmodulin regulated spectrin-associated protein 1-like 1

Mapping InformationHelp
RH101923 Sequence Map: Chr 1|HuRef Map Viewer
  Position: 171994356-171994487 (bp)
 
RH101923 Sequence Map: Chr 1|Celera Map Viewer
  Position: 173951297-173951428 (bp)
 
RH101923 Sequence Map: Chr 1 Map Viewer
  Position: 200827226-200827357 (bp)
 
stSG51720 GeneMap99-GB4 Map: Chr 1 Map Viewer
  Position: 665.11 (cR3000)
  Lod score: 1.07
  Reference Interval: D1S2622-D1S306

Electronic PCR results Help
RefSeq mRNA (1)
NM_203459.1 4746 .. 4877 (132 bp)  
 
mRNA (3)
BC011385.1 1211 .. 1342 (132 bp)  
AB029001.2 4137 .. 4268 (132 bp)  
BC065508.1 3097 .. 3228 (132 bp)  
 
Genomic RefSeqs (5 of 6)[Show All Hits]
NW_926128.1 39206056 .. 39206187 (132 bp)  
AC_000044.1 173951297 .. 173951428 (132 bp)  
AC_000133.1 171994356 .. 171994487 (132 bp)  
NW_001838533.2 5110764 .. 5110895 (132 bp)  
NT_004487.19 52315868 .. 52315999 (132 bp)  
 
Genomic (2)
AL450104.14 149262 .. 149393 (132 bp)  
AC099756.2 40219 .. 40350 (132 bp)  
 
Working Draft phase 1 (from GenBank HTGS division) (2)
AC025349.2 161737 .. 161868 (132 bp)  
AC027113.3 117168 .. 117299 (132 bp)  
 
ESTs (5 of 17)[Show All Hits]
N94708.1 166 .. 297 (132 bp)  
N95701.1 165 .. 296 (132 bp)  
AA031980.1 127 .. 258 (132 bp)  
AI080092.1 133 .. 264 (132 bp)  
BG623319.1 148 .. 279 (132 bp)  
 
Whole Genome Shotgun sequences (5)
AADD01011703.1 3341 .. 3472 (132 bp)  
AADC01009767.1 13869 .. 14000 (132 bp)  
AADB02001065.1 210324 .. 210455 (132 bp)  
ABBA01027542.1 24178 .. 24309 (132 bp)  
ABSL01055473.1 24176 .. 24307 (132 bp)  
 
Patent sequences (4)
AX336867.1 127 .. 258 (132 bp)  
BD457114.1 2622 .. 2753 (132 bp)  
DL068263.1 127 .. 258 (132 bp)  
HA137695.1 166 .. 297 (132 bp)  
 
High Thoughput cDNA sequences (1)
AL110158.1 659 .. 790 (132 bp)  
 

   Macaca mulatta
Name: RH101923
Polymorphism info:  

Cross References Help
Gene GeneID:709092
 Symbol:LOC709092
 Description:similar to calmodulin regulated spectrin-associated protein 1-like 1
 Position: 
UniGeneMmu.13923 Similar to calmodulin regulated spectrin-associated protein 1-like 1

Mapping InformationHelp
RH101923 Sequence Map: Chr 1 Map Viewer
  Position: 169635636-169635767 (bp)

Electronic PCR results Help
RefSeq mRNA (1)
XM_001109492.1 4733 .. 4864 (132 bp)  
 
Genomic RefSeqs (1)
NW_001109048.1 3396914 .. 3397045 (132 bp)  
 
Whole Genome Shotgun sequences (1)
AANU01241850.1 21502 .. 21633 (132 bp)  
 

   Pan troglodytes
Name: RH101923
Polymorphism info:  

Cross References Help
Gene GeneID:457611
 Symbol:CAMSAP1L1
 Description:calmodulin regulated spectrin-associated protein 1-like 1
 Position: 

Mapping InformationHelp
RH101923 Sequence Map: Chr 1 Map Viewer
  Position: 180850803-180850934 (bp)

Electronic PCR results Help
RefSeq mRNA (5)
XM_001144062.1 4773 .. 4904 (132 bp)  
XM_514085.2 4740 .. 4871 (132 bp)  
XM_001143924.1 4692 .. 4823 (132 bp)  
XM_001143855.1 4749 .. 4880 (132 bp)  
XM_001143995.1 4539 .. 4670 (132 bp)  
 
Genomic RefSeqs (1)
NW_001229611.1 4013002 .. 4013133 (132 bp)  
 
Whole Genome Shotgun sequences (2)
AADA01072568.1 2970 .. 3101 (132 bp)  
AACZ02012051.1 8556 .. 8687 (132 bp)  
 

   Pongo abelii
 
Polymorphism info:  

Electronic PCR results Help
Whole Genome Shotgun sequences (1)
ABGA01386314.1 13755 .. 13886 (132 bp)  
 

   Tupaia belangeri
 
Polymorphism info:  

Electronic PCR results Help
Whole Genome Shotgun sequences (1)
AAPY01333693.1 738 .. 868 (131 bp)  
 

 

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement