PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:95029 Links G43583 Homo sapiens chromosome 15, locus CYFIP1 Pan troglodytes chromosome 15, locus NIPA2 Found by e-PCR in sequences from Homo sapiens, Pan troglodytes and Pongo abelii. Primer Information Forward primer: GTCCTCAAGGGGGAGAAAAC Reverse primer: GCAGCTCACCACTGGCTG PCR product size: 200 (bp), Homo sapiens GenBank Accession: G43583 G43585    Homo sapiens Name: G43583 Also known as: WIAF-2456-STS WIAF-2458-STS Polymorphism info:   Cross References Gene GeneID: 23191   Symbol: CYFIP1   Description: cytoplasmic FMR1 interacting protein 1   Position: 15q11 UniGene Hs.26704 Cytoplasmic FMR1 interacting protein 1   Hs.591003 Non imprinted in Prader-Willi/Angelman syndrome 2 Mapping Information G43583 Sequence Map: Chr 15|HuRef Map Viewer   Position: 1317120-1317319 (bp)   G43583 Sequence Map: Chr 15|Celera Map Viewer   Position: 1374876-1375075 (bp)   G43583 Sequence Map: Chr 15 Map Viewer   Position: 23004737-23004936 (bp) Electronic PCR results mRNA (4) G43583.1 1 .. 200 (200 bp)   G43585.1 1 .. 200 (200 bp)   AK127094.1 4464 .. 4663 (200 bp)   AY763579.1 4464 .. 4663 (200 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_925761.1 93330 .. 93529 (200 bp)   AC_000058.1 1374876 .. 1375075 (200 bp)   AC_000147.1 1317120 .. 1317319 (200 bp)   NW_001838191.2 318128 .. 318327 (200 bp)   NT_078094.2 358544 .. 358743 (200 bp)     Genomic (2) AC016204.12 32548 .. 32747 (200 bp)   AC011767.12 31514 .. 31713 (200 bp)     ESTs (5 of 31)[Show All Hits] F09926.1 138 .. 337 (200 bp)   N34304.1 60 .. 259 (200 bp)   N52029.1 51 .. 251 (201 bp)   W45351.1 50 .. 249 (200 bp)   W45352.1 51 .. 251 (201 bp)     Whole Genome Shotgun sequences (5) AADD01141596.1 2953 .. 3152 (200 bp)   AADC01118922.1 8125 .. 8324 (200 bp)   AADB02016226.1 13579 .. 13778 (200 bp)   ABBA01040251.1 2664 .. 2863 (200 bp)   ABSL01063480.1 2670 .. 2869 (200 bp)     Patent sequences (3) AX780127.1 2720 .. 2919 (200 bp)   CQ850015.1 4464 .. 4663 (200 bp)   DL210638.1 4464 .. 4663 (200 bp)     High Thoughput cDNA sequences (1) CR595946.1 410 .. 609 (200 bp)        Pan troglodytes Name: G43583 Polymorphism info:   Cross References Gene GeneID: 453275   Symbol: NIPA2   Description: non imprinted in Prader-Willi/Angelman syndrome 2   Position:   Mapping Information G43583 Sequence Map: Chr 15 Map Viewer   Position: 20582063-20582267 (bp) Electronic PCR results RefSeq mRNA (5 of 14)[Show All Hits] XM_001158930.1 2739 .. 2943 (205 bp)   XM_001158981.1 2679 .. 2883 (205 bp)   XM_001159024.1 2966 .. 3170 (205 bp)   XM_001159070.1 2821 .. 3025 (205 bp)   XM_510259.2 2963 .. 3167 (205 bp)     Genomic RefSeqs (1) NW_001225210.1 269986 .. 270190 (205 bp)     Whole Genome Shotgun sequences (2) AADA01290233.1 14900 .. 15104 (205 bp)   AACZ02153306.1 29905 .. 30109 (205 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01080819.1 10773 .. 10979 (207 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement