PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:91793 Links RH25390 Homo sapiens loci KIAA0174 and LOC728533 Macaca mulatta chromosome 20;11, loci LOC709385, KIAA0174, and LOC707143 Pan troglodytes loci LOC745404 and LOC456001 Found by e-PCR in sequences from Homo sapiens, Macaca fascicularis, Macaca mulatta, Macaca nemestrina, Pan troglodytes and Pongo abelii. Primer Information Forward primer: TGGATGGATGGGACTCTTATG Reverse primer: GTATCATCCAATCCCAAAGCC PCR product size: 99 (bp), Homo sapiens    Homo sapiens Warning! This marker matched more than 2 locations on genome by e-PCR and therefore excluded from annotation. Name: RH25390 Polymorphism info:   Cross References Gene GeneID: 728533   Symbol: LOC728533   Description: similar to CG10103   Position: 19q13.12 Gene GeneID: 9798   Symbol: KIAA0174   Description: KIAA0174   Position: 16q22.2 UniGene Hs.232194 KIAA0174   Hs.651115 Transcribed locus, strongly similar to NP_001017454.1 hypothetical protein L... Electronic PCR results RefSeq mRNA (4) NM_014761.2 2134 .. 2232 (99 bp)   XR_015610.3 1881 .. 1978 (98 bp)   XR_019503.3 1881 .. 1978 (98 bp)   XR_038917.2 1881 .. 1978 (98 bp)     mRNA (5 of 8)[Show All Hits] D79996.1 2133 .. 2231 (99 bp)   AL355695.1 1186 .. 1284 (99 bp)   BC000116.1 2035 .. 2133 (99 bp)   BC004359.1 2134 .. 2232 (99 bp)   AK057902.1 2151 .. 2249 (99 bp)     Genomic RefSeqs (5 of 18)[Show All Hits] NT_010498.15 25576890 .. 25576988 (99 bp)   NW_925395.1 3334063 .. 3334160 (98 bp)   NW_926517.1 768745 .. 768843 (99 bp)   NW_927217.1 491602 .. 491699 (98 bp)   AC_000055.1 55710234 .. 55710331 (98 bp)     Genomic (5) G06036.1 118 .. 216 (99 bp)   AC007676.19 123955 .. 124052 (98 bp)   AC009779.18 73119 .. 73216 (98 bp)   AC016582.9 55072 .. 55169 (98 bp)   AC009127.10 83498 .. 83596 (99 bp)     ESTs (5 of 201)[Show All Hits] T06627.1 115 .. 213 (99 bp)   T17335.1 120 .. 218 (99 bp)   Z38301.1 118 .. 216 (99 bp)   T32093.1 118 .. 216 (99 bp)   T33794.1 120 .. 218 (99 bp)     Whole Genome Shotgun sequences (5 of 14)[Show All Hits] AADD01165228.1 15446 .. 15543 (98 bp)   AADD01149895.1 1132 .. 1230 (99 bp)   AADD01124344.1 8054 .. 8151 (98 bp)   AADC01139088.1 29682 .. 29779 (98 bp)   AADC01126848.1 15886 .. 15984 (99 bp)     Patent sequences (5 of 23)[Show All Hits] BD186186.1 2109 .. 2207 (99 bp)   BD186187.1 1339 .. 1437 (99 bp)   BD186188.1 2167 .. 2265 (99 bp)   BD190288.1 2133 .. 2231 (99 bp)   BD190290.1 1339 .. 1437 (99 bp)     High Thoughput cDNA sequences (4) CR592890.1 1440 .. 1538 (99 bp)   CR608887.1 1629 .. 1727 (99 bp)   CR623090.1 1845 .. 1943 (99 bp)   BC006261.1 2946 .. 3044 (99 bp)        Macaca fascicularis   Polymorphism info:   Cross References UniGene Mfa.2972 Brain cDNA clone: QbsB-10942, similar to human LOC400545 (LOC400545), mRNA, ... Electronic PCR results mRNA (2) AB170236.1 1473 .. 1570 (98 bp)   AB174309.1 1615 .. 1712 (98 bp)        Macaca mulatta Name: RH25390 Polymorphism info:   Cross References Gene GeneID: 707143   Symbol: LOC707143   Description: similar to polycystic kidney disease 1 like 3   Position:   Gene GeneID: 707245   Symbol: KIAA0174   Description: KIAA0174   Position:   Gene GeneID: 709385   Symbol: LOC709385   Description: similar to protein kinase, interferon-inducible double stranded RNA dependent activator   Position:   UniGene Mmu.13031 KIAA0174 Mapping Information RH25390 Sequence Map: Chr 11 Map Viewer   Position: 52717181-52717278 (bp)   RH25390 Sequence Map: Chr 20 Map Viewer   Position: 70722595-70722692 (bp) Electronic PCR results RefSeq mRNA (5 of 6)[Show All Hits] XM_001104896.1 1506 .. 1603 (98 bp)   XM_001105424.1 2176 .. 2273 (98 bp)   XM_001105348.1 2134 .. 2231 (98 bp)   XM_001105281.1 2083 .. 2180 (98 bp)   XM_001105049.1 2271 .. 2368 (98 bp)     Genomic RefSeqs (2) NW_001096623.1 2123020 .. 2123117 (98 bp)   NW_001111354.1 6804261 .. 6804358 (98 bp)     Genomic (1) AC197751.3 168987 .. 169084 (98 bp)     ESTs (1) CB310489.1 120 .. 217 (98 bp)     Whole Genome Shotgun sequences (3) AANU01281097.1 8894 .. 8991 (98 bp)   AANU01177709.1 15282 .. 15379 (98 bp)   AANU01101874.1 16337 .. 16435 (99 bp)        Macaca nemestrina   Polymorphism info:   Electronic PCR results ESTs (2) DY751616.1 71 .. 168 (98 bp)   EB526206.1 63 .. 160 (98 bp)        Pan troglodytes Warning! This marker matched more than 2 locations on genome by e-PCR and therefore excluded from annotation.   Polymorphism info:   Cross References Gene GeneID: 456001   Symbol: LOC456001   Description: similar to KIAA0174 protein   Position:   Gene GeneID: 745404   Symbol: LOC745404   Description: similar to KIAA0174   Position:   Electronic PCR results RefSeq mRNA (2) XM_001151193.1 2481 .. 2579 (99 bp)   XR_024948.1 2161 .. 2258 (98 bp)     Genomic RefSeqs (3) NW_001223153.1 12614806 .. 12614903 (98 bp)   NW_001226058.1 1771067 .. 1771165 (99 bp)   NW_001228224.1 2124464 .. 2124561 (98 bp)     Genomic (1) AC195070.2 127012 .. 127109 (98 bp)     Whole Genome Shotgun sequences (5 of 6)[Show All Hits] AADA01285054.1 2138 .. 2236 (99 bp)   AADA01153961.1 2790 .. 2887 (98 bp)   AADA01134282.1 6472 .. 6569 (98 bp)   AACZ02184936.1 6657 .. 6754 (98 bp)   AACZ02164143.1 2645 .. 2743 (99 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results RefSeq mRNA (1) NM_001133078.1 2111 .. 2209 (99 bp)     Whole Genome Shotgun sequences (3) ABGA01245476.1 1980 .. 2077 (98 bp)   ABGA01136350.1 3108 .. 3205 (98 bp)   ABGA01043812.1 1833 .. 1931 (99 bp)     High Thoughput cDNA sequences (1) CR860522.1 2111 .. 2209 (99 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement