PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:89715 Links RH64908 Homo sapiens chromosome 15, loci NIPA2 and CYFIP1 Pan troglodytes chromosome 15, locus NIPA2 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: GGTAATCAAGGTTCCAGGCA Reverse primer: TCCTCTGAGCATTCGATGG PCR product size: 123 (bp), Homo sapiens    Homo sapiens Name: RH64908 Also known as: stSG4789 Polymorphism info:   Cross References Gene GeneID: 23191   Symbol: CYFIP1   Description: cytoplasmic FMR1 interacting protein 1   Position: 15q11 Gene GeneID: 81614   Symbol: NIPA2   Description: non imprinted in Prader-Willi/Angelman syndrome 2   Position: 15q11.2 UniGene Hs.26704 Cytoplasmic FMR1 interacting protein 1   Hs.591003 Non imprinted in Prader-Willi/Angelman syndrome 2 Mapping Information RH64908 Sequence Map: Chr 15|HuRef Map Viewer   Position: 1317871-1317992 (bp)   RH64908 Sequence Map: Chr 15|Celera Map Viewer   Position: 1374203-1374324 (bp)   RH64908 Sequence Map: Chr 15 Map Viewer   Position: 23005488-23005609 (bp) Electronic PCR results RefSeq mRNA (4) NM_001008860.1 2186 .. 2307 (122 bp)   NM_030922.5 2308 .. 2429 (122 bp)   NM_001008894.1 1993 .. 2114 (122 bp)   NM_001008892.1 2050 .. 2171 (122 bp)     mRNA (5 of 8)[Show All Hits] U90904.1 1161 .. 1282 (122 bp)   AK096305.1 2083 .. 2204 (122 bp)   BC011775.2 1981 .. 2102 (122 bp)   AK127094.1 5220 .. 5341 (122 bp)   BC000957.3 1499 .. 1620 (122 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_925761.1 92657 .. 92778 (122 bp)   AC_000058.1 1374203 .. 1374324 (122 bp)   AC_000147.1 1317871 .. 1317992 (122 bp)   NW_001838191.2 317455 .. 317576 (122 bp)   NT_078094.2 359295 .. 359416 (122 bp)     Genomic (2) AC016204.12 33299 .. 33420 (122 bp)   AC011767.12 32265 .. 32386 (122 bp)     ESTs (5 of 127)[Show All Hits] T16604.1 140 .. 261 (122 bp)   T66278.1 101 .. 222 (122 bp)   F12299.1 110 .. 231 (122 bp)   R38195.1 155 .. 276 (122 bp)   R61323.1 149 .. 271 (123 bp)     Whole Genome Shotgun sequences (5) AADD01141596.1 2275 .. 2396 (122 bp)   AADC01118922.1 8881 .. 9002 (122 bp)   AADB02016226.1 12906 .. 13027 (122 bp)   ABBA01040251.1 1991 .. 2112 (122 bp)   ABSL01063480.1 1992 .. 2113 (122 bp)     Patent sequences (5 of 24)[Show All Hits] AX410811.1 1161 .. 1282 (122 bp)   AX454746.1 1297 .. 1418 (122 bp)   AX491224.1 1297 .. 1418 (122 bp)   AX780127.1 2042 .. 2163 (122 bp)   CQ850015.1 5220 .. 5341 (122 bp)     High Thoughput cDNA sequences (2) CR606982.1 2023 .. 2144 (122 bp)   CR625512.1 1193 .. 1314 (122 bp)        Pan troglodytes Name: RH64908 Polymorphism info:   Cross References Gene GeneID: 453275   Symbol: NIPA2   Description: non imprinted in Prader-Willi/Angelman syndrome 2   Position:   Mapping Information RH64908 Sequence Map: Chr 15 Map Viewer   Position: 20582826-20582947 (bp) Electronic PCR results RefSeq mRNA (5 of 14)[Show All Hits] XM_001158930.1 2059 .. 2180 (122 bp)   XM_001158981.1 1999 .. 2120 (122 bp)   XM_001159024.1 2286 .. 2407 (122 bp)   XM_001159070.1 2141 .. 2262 (122 bp)   XM_510259.2 2283 .. 2404 (122 bp)     Genomic RefSeqs (1) NW_001225210.1 270749 .. 270870 (122 bp)     Whole Genome Shotgun sequences (2) AADA01290233.1 15663 .. 15784 (122 bp)   AACZ02153306.1 30668 .. 30789 (122 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement