ncbi logo
UniSTS logo
 PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure
  Search for

Entrez UniSTS
Help
Query tips
Submit
Submit map
FTP site
Statistics

Related sites
e-PCR
Map Viewer
Gene
UniGene
dbSNP
GeneMap'99
MGD
ZFIN

Genomic biology
Bos taurus
Canis familiaris
Danio rerio
Homo sapiens
Mus musculus
Rattus novegicus
Sus scrofa

UniSTS:89715 Links
RH64908
Homo sapiens chromosome 15, loci NIPA2 and CYFIP1
Pan troglodytes chromosome 15, locus NIPA2

Found by e-PCR in sequences from Homo sapiens and Pan troglodytes.

Primer InformationHelp

Forward primer:GGTAATCAAGGTTCCAGGCA
Reverse primer:TCCTCTGAGCATTCGATGG
PCR product size:123 (bp), Homo sapiens

   Homo sapiens
Name: RH64908
Also known as: stSG4789
Polymorphism info:  

Cross References Help
Gene GeneID:23191
 Symbol:CYFIP1
 Description:cytoplasmic FMR1 interacting protein 1
 Position:15q11
Gene GeneID:81614
 Symbol:NIPA2
 Description:non imprinted in Prader-Willi/Angelman syndrome 2
 Position:15q11.2
UniGeneHs.26704 Cytoplasmic FMR1 interacting protein 1
 Hs.591003 Non imprinted in Prader-Willi/Angelman syndrome 2

Mapping InformationHelp
RH64908 Sequence Map: Chr 15|HuRef Map Viewer
  Position: 1317871-1317992 (bp)
 
RH64908 Sequence Map: Chr 15|Celera Map Viewer
  Position: 1374203-1374324 (bp)
 
RH64908 Sequence Map: Chr 15 Map Viewer
  Position: 23005488-23005609 (bp)

Electronic PCR results Help
RefSeq mRNA (4)
NM_001008860.1 2186 .. 2307 (122 bp)  
NM_030922.5 2308 .. 2429 (122 bp)  
NM_001008894.1 1993 .. 2114 (122 bp)  
NM_001008892.1 2050 .. 2171 (122 bp)  
 
mRNA (5 of 8)[Show All Hits]
U90904.1 1161 .. 1282 (122 bp)  
AK096305.1 2083 .. 2204 (122 bp)  
BC011775.2 1981 .. 2102 (122 bp)  
AK127094.1 5220 .. 5341 (122 bp)  
BC000957.3 1499 .. 1620 (122 bp)  
 
Genomic RefSeqs (5 of 6)[Show All Hits]
NW_925761.1 92657 .. 92778 (122 bp)  
AC_000058.1 1374203 .. 1374324 (122 bp)  
AC_000147.1 1317871 .. 1317992 (122 bp)  
NW_001838191.2 317455 .. 317576 (122 bp)  
NT_078094.2 359295 .. 359416 (122 bp)  
 
Genomic (2)
AC016204.12 33299 .. 33420 (122 bp)  
AC011767.12 32265 .. 32386 (122 bp)  
 
ESTs (5 of 127)[Show All Hits]
T16604.1 140 .. 261 (122 bp)  
T66278.1 101 .. 222 (122 bp)  
F12299.1 110 .. 231 (122 bp)  
R38195.1 155 .. 276 (122 bp)  
R61323.1 149 .. 271 (123 bp)  
 
Whole Genome Shotgun sequences (5)
AADD01141596.1 2275 .. 2396 (122 bp)  
AADC01118922.1 8881 .. 9002 (122 bp)  
AADB02016226.1 12906 .. 13027 (122 bp)  
ABBA01040251.1 1991 .. 2112 (122 bp)  
ABSL01063480.1 1992 .. 2113 (122 bp)  
 
Patent sequences (5 of 24)[Show All Hits]
AX410811.1 1161 .. 1282 (122 bp)  
AX454746.1 1297 .. 1418 (122 bp)  
AX491224.1 1297 .. 1418 (122 bp)  
AX780127.1 2042 .. 2163 (122 bp)  
CQ850015.1 5220 .. 5341 (122 bp)  
 
High Thoughput cDNA sequences (2)
CR606982.1 2023 .. 2144 (122 bp)  
CR625512.1 1193 .. 1314 (122 bp)  
 

   Pan troglodytes
Name: RH64908
Polymorphism info:  

Cross References Help
Gene GeneID:453275
 Symbol:NIPA2
 Description:non imprinted in Prader-Willi/Angelman syndrome 2
 Position: 

Mapping InformationHelp
RH64908 Sequence Map: Chr 15 Map Viewer
  Position: 20582826-20582947 (bp)

Electronic PCR results Help
RefSeq mRNA (5 of 14)[Show All Hits]
XM_001158930.1 2059 .. 2180 (122 bp)  
XM_001158981.1 1999 .. 2120 (122 bp)  
XM_001159024.1 2286 .. 2407 (122 bp)  
XM_001159070.1 2141 .. 2262 (122 bp)  
XM_510259.2 2283 .. 2404 (122 bp)  
 
Genomic RefSeqs (1)
NW_001225210.1 270749 .. 270870 (122 bp)  
 
Whole Genome Shotgun sequences (2)
AADA01290233.1 15663 .. 15784 (122 bp)  
AACZ02153306.1 30668 .. 30789 (122 bp)  
 

 

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement