PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:89511 Links RH91787 Homo sapiens chromosome 15, loci NIPA2 and CYFIP1 Macaca mulatta chromosome 7, locus LOC710147 Pan troglodytes chromosome 15, locus NIPA2 Found by e-PCR in sequences from Homo sapiens, Macaca mulatta, Pan troglodytes and Pongo abelii. Primer Information Forward primer: GGCCCAAAGGAGCTCTTAAG Reverse primer: TTAGACTTTGAACAGCTCTGGG PCR product size: 184 (bp), Homo sapiens    Homo sapiens Name: RH91787 Also known as: stSG45529 Polymorphism info:   Cross References Gene GeneID: 23191   Symbol: CYFIP1   Description: cytoplasmic FMR1 interacting protein 1   Position: 15q11 Gene GeneID: 81614   Symbol: NIPA2   Description: non imprinted in Prader-Willi/Angelman syndrome 2   Position: 15q11.2 UniGene Hs.26704 Cytoplasmic FMR1 interacting protein 1   Hs.591003 Non imprinted in Prader-Willi/Angelman syndrome 2 Mapping Information RH91787 Sequence Map: Chr 15|HuRef Map Viewer   Position: 1317630-1317813 (bp)   RH91787 Sequence Map: Chr 15|Celera Map Viewer   Position: 1374382-1374565 (bp)   RH91787 Sequence Map: Chr 15 Map Viewer   Position: 23005247-23005430 (bp)   stSG45529 GeneMap99-GB4 Map: Chr 15 Map Viewer   Position: 19.24 (cR3000)   Lod score: 2.36   Reference Interval: pTEL-D15S122 Electronic PCR results mRNA (2) AK127094.1 4978 .. 5162 (185 bp)   AY763579.1 4978 .. 5162 (185 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_925761.1 92836 .. 93019 (184 bp)   AC_000058.1 1374382 .. 1374565 (184 bp)   AC_000147.1 1317630 .. 1317813 (184 bp)   NW_001838191.2 317634 .. 317817 (184 bp)   NT_078094.2 359054 .. 359237 (184 bp)     Genomic (3) G11828.1 107 .. 290 (184 bp)   AC016204.12 33058 .. 33241 (184 bp)   AC011767.12 32024 .. 32207 (184 bp)     ESTs (5 of 17)[Show All Hits] Z39245.1 107 .. 290 (184 bp)   T66278.1 280 .. 468 (189 bp)   R56244.1 119 .. 302 (184 bp)   AI085918.1 116 .. 300 (185 bp)   AI491861.1 111 .. 295 (185 bp)     Whole Genome Shotgun sequences (5) AADD01141596.1 2454 .. 2638 (185 bp)   AADC01118922.1 8639 .. 8823 (185 bp)   AADB02016226.1 13085 .. 13268 (184 bp)   ABBA01040251.1 2170 .. 2353 (184 bp)   ABSL01063480.1 2171 .. 2355 (185 bp)     Patent sequences (4) AX780127.1 2221 .. 2405 (185 bp)   CQ850015.1 4978 .. 5162 (185 bp)   CQ855169.1 2140 .. 2323 (184 bp)   DL210638.1 4978 .. 5162 (185 bp)        Macaca mulatta Name: RH91787 Polymorphism info:   Cross References Gene GeneID: 710147   Symbol: LOC710147   Description: similar to non imprinted in Prader-Willi/Angelman syndrome 2 isoform a   Position:   UniGene Mmu.13329 Similar to non imprinted in Prader-Willi/Angelman syndrome 2 isoform a Mapping Information RH91787 Sequence Map: Chr 7 Map Viewer   Position: 1784377-1784556 (bp) Electronic PCR results RefSeq mRNA (5) XM_001106072.1 2454 .. 2633 (180 bp)   XM_001106137.1 2360 .. 2539 (180 bp)   XM_001106204.1 2475 .. 2654 (180 bp)   XM_001106265.1 2220 .. 2399 (180 bp)   XM_001105995.1 2148 .. 2327 (180 bp)     Genomic RefSeqs (1) NW_001121136.1 237838 .. 238017 (180 bp)     Whole Genome Shotgun sequences (1) AANU01129034.1 7792 .. 7971 (180 bp)        Pan troglodytes Name: RH91787 Polymorphism info:   Cross References Gene GeneID: 453275   Symbol: NIPA2   Description: non imprinted in Prader-Willi/Angelman syndrome 2   Position:   Mapping Information RH91787 Sequence Map: Chr 15 Map Viewer   Position: 20582579-20582764 (bp) Electronic PCR results RefSeq mRNA (5 of 14)[Show All Hits] XM_001158930.1 2242 .. 2427 (186 bp)   XM_001158981.1 2182 .. 2367 (186 bp)   XM_001159024.1 2469 .. 2654 (186 bp)   XM_001159070.1 2324 .. 2509 (186 bp)   XM_510259.2 2466 .. 2651 (186 bp)     Genomic RefSeqs (1) NW_001225210.1 270502 .. 270687 (186 bp)     Whole Genome Shotgun sequences (2) AADA01290233.1 15416 .. 15601 (186 bp)   AACZ02153306.1 30421 .. 30606 (186 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01080819.1 10284 .. 10477 (194 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement