PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:88623 Links RH18371 Homo sapiens chromosome 7, loci SBDS and SBDSP Macaca mulatta chromosome 3 Pan troglodytes chromosome 7, loci LOC741794 and SBDS Found by e-PCR in sequences from Canis lupus, Homo sapiens, Macaca mulatta, Pan troglodytes, Papio anubis and Pongo abelii. Primer Information Forward primer: GAGTGGTTTTATTGATTACATAC Reverse primer: CTGCCATAACTTAGATTATTCT PCR product size: 115 (bp), Homo sapiens    Canis lupus   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) AAEX02004572.1 115073 .. 115184 (112 bp)        Homo sapiens Name: RH18371 Also known as: A007T29 stSG9902 Polymorphism info:   Cross References Gene GeneID: 155370   Symbol: SBDSP   Description: Shwachman-Bodian-Diamond syndrome pseudogene   Position: 7q11.23 Gene GeneID: 51119   Symbol: SBDS   Description: Shwachman-Bodian-Diamond syndrome   Position: 7q11.21 UniGene Hs.110445 Shwachman-Bodian-Diamond syndrome   Hs.585053 Transcribed locus, strongly similar to NP_057122.2 Shwachman-Bodian-Diamond ... Mapping Information RH18371 Sequence Map: Chr 7|HuRef Map Viewer   Position: 62635780-62635894 (bp)   RH18371 Sequence Map: Chr 7|Celera Map Viewer   Position: 65663394-65663508 (bp)   RH18371 Sequence Map: Chr 7|CRA_TCAGchr7v2 Map Viewer   Position: 65790263-65790377 (bp)   RH18371 Sequence Map: Chr 7 Map Viewer   Position: 66452701-66452815 (bp)   RH18371 Sequence Map: Chr 7|HuRef Map Viewer   Position: 68475952-68476066 (bp)   RH18371 Sequence Map: Chr 7|Celera Map Viewer   Position: 69784520-69784634 (bp)   RH18371 Sequence Map: Chr 7|CRA_TCAGchr7v2 Map Viewer   Position: 71640649-71640763 (bp)   RH18371 Sequence Map: Chr 7 Map Viewer   Position: 72307827-72307941 (bp) Electronic PCR results RefSeq mRNA (1) NM_016038.2 1480 .. 1594 (115 bp)     mRNA (3) AK001779.1 1479 .. 1593 (115 bp)   AY169963.1 1480 .. 1594 (115 bp)   BC065700.1 1450 .. 1564 (115 bp)     Genomic RefSeqs (5 of 17)[Show All Hits] NW_923417.1 5640923 .. 5641037 (115 bp)   NW_923462.1 103708 .. 103822 (115 bp)   NT_079593.2 4485511 .. 4485625 (115 bp)   NT_079593.2 10335897 .. 10336011 (115 bp)   AC_000050.1 65663394 .. 65663508 (115 bp)     Genomic (5 of 10)[Show All Hits] G11487.1 13 .. 127 (115 bp)   AC005236.4 62478 .. 62592 (115 bp)   AC079920.6 51272 .. 51386 (115 bp)   AC208947.3 13166 .. 13280 (115 bp)   AC211469.4 71377 .. 71491 (115 bp)     Working Draft phase 1 (from GenBank HTGS division) (4) AC204989.3 204461 .. 204575 (115 bp)   AC211482.3 222672 .. 222786 (115 bp)   AC211506.3 209868 .. 209982 (115 bp)   AC211426.3 132324 .. 132438 (115 bp)     ESTs (5 of 146)[Show All Hits] T55337.1 13 .. 127 (115 bp)   R19215.1 14 .. 128 (115 bp)   AA025525.1 26 .. 140 (115 bp)   AA028934.1 12 .. 126 (115 bp)   AA044743.1 17 .. 131 (115 bp)     Whole Genome Shotgun sequences (5 of 10)[Show All Hits] AADD01082184.1 1429 .. 1543 (115 bp)   AADD01081607.1 6380 .. 6494 (115 bp)   AADC01069123.1 10422 .. 10536 (115 bp)   AACC02000112.1 130200 .. 130314 (115 bp)   AADB02010653.1 3204 .. 3318 (115 bp)     Patent sequences (5 of 11)[Show All Hits] BD154038.1 12 .. 126 (115 bp)   BD156702.1 1479 .. 1593 (115 bp)   AX873976.1 12 .. 126 (115 bp)   AX877524.1 1479 .. 1593 (115 bp)   CQ787569.1 1479 .. 1593 (115 bp)     Other sequences (2) NR_024110.1 1567 .. 1681 (115 bp)   NR_024111.1 1445 .. 1559 (115 bp)     High Thoughput cDNA sequences (5) CR591576.1 1451 .. 1565 (115 bp)   CR613195.1 425 .. 539 (115 bp)   CR613995.1 1465 .. 1579 (115 bp)   CR620464.1 722 .. 836 (115 bp)   CR626007.1 1479 .. 1593 (115 bp)        Macaca mulatta Name: RH18371 Polymorphism info:   Cross References UniGene Mmu.3928 Similar to Shwachman-Bodian-Diamond syndrome protein Mapping Information RH18371 Sequence Map: Chr 3 Map Viewer   Position: 58057508-58057622 (bp) Electronic PCR results Genomic RefSeqs (1) NW_001114214.1 475774 .. 475888 (115 bp)     ESTs (1) EG704690.1 30 .. 144 (115 bp)     Whole Genome Shotgun sequences (1) AANU01191514.1 1260 .. 1374 (115 bp)        Pan troglodytes Name: RH18371 Polymorphism info:   Cross References Gene GeneID: 463942   Symbol: SBDS   Description: Shwachman-Bodian-Diamond syndrome   Position:   Gene GeneID: 741794   Symbol: LOC741794   Description: hypothetical protein LOC741794   Position:   Mapping Information RH18371 Sequence Map: Chr 7 Map Viewer   Position: 72720343-72720457 (bp) Electronic PCR results RefSeq mRNA (4) XM_001141579.1 1572 .. 1683 (112 bp)   XM_519568.2 1525 .. 1636 (112 bp)   XM_001141242.1 1525 .. 1636 (112 bp)   XR_020462.1 1523 .. 1637 (115 bp)     Genomic RefSeqs (1) NW_001238041.1 31046 .. 31160 (115 bp)     Genomic (3) AC173999.3 84079 .. 84193 (115 bp)   AC190222.1 80929 .. 81043 (115 bp)   AC193200.4 64230 .. 64341 (112 bp)     Whole Genome Shotgun sequences (3) AADA01177866.1 6250 .. 6364 (115 bp)   AACZ02084571.1 6244 .. 6358 (115 bp)   AACZ02084051.1 1388 .. 1499 (112 bp)        Papio anubis   Polymorphism info:   Electronic PCR results ESTs (1) GE868500.1 554 .. 668 (115 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results RefSeq mRNA (1) NM_001132146.1 1466 .. 1580 (115 bp)     Genomic (1) AC206529.4 99111 .. 99225 (115 bp)     Whole Genome Shotgun sequences (1) ABGA01352666.1 1387 .. 1501 (115 bp)     High Thoughput cDNA sequences (1) CR858869.1 1466 .. 1580 (115 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement