PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:87613 Links RH94274 Homo sapiens chromosome 15, locus CYFIP1 Pan troglodytes chromosome 15, locus NIPA2 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: CTACTTTTCTGTGCCGTGCA Reverse primer: TGGAGTATTGCAACCTTCACC PCR product size: 135 (bp), Homo sapiens    Homo sapiens Name: RH94274 Also known as: stSG52513 Polymorphism info:   Cross References Gene GeneID: 23191   Symbol: CYFIP1   Description: cytoplasmic FMR1 interacting protein 1   Position: 15q11 UniGene Hs.26704 Cytoplasmic FMR1 interacting protein 1   Hs.642349 Transcribed locus Mapping Information RH94274 Sequence Map: Chr 15|HuRef Map Viewer   Position: 1316631-1316765 (bp)   RH94274 Sequence Map: Chr 15|Celera Map Viewer   Position: 1375427-1375561 (bp)   RH94274 Sequence Map: Chr 15 Map Viewer   Position: 23004251-23004385 (bp)   stSG52513 GeneMap99-GB4 Map: Chr 15 Map Viewer   Position: 23.86 (cR3000)   Lod score: 3.00   Reference Interval: pTEL-D15S122 Electronic PCR results mRNA (2) AK127094.1 3978 .. 4112 (135 bp)   AY763579.1 3978 .. 4112 (135 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_925761.1 93881 .. 94015 (135 bp)   AC_000058.1 1375427 .. 1375561 (135 bp)   AC_000147.1 1316631 .. 1316765 (135 bp)   NW_001838191.2 318682 .. 318816 (135 bp)   NT_078094.2 358058 .. 358192 (135 bp)     Genomic (2) AC016204.12 32062 .. 32196 (135 bp)   AC011767.12 31028 .. 31162 (135 bp)     ESTs (2) AA778837.1 330 .. 464 (135 bp)   DB541111.1 215 .. 349 (135 bp)     Whole Genome Shotgun sequences (5) AADD01141596.1 3509 .. 3643 (135 bp)   AADC01118922.1 7639 .. 7773 (135 bp)   AADB02016226.1 14130 .. 14264 (135 bp)   ABBA01040251.1 3218 .. 3352 (135 bp)   ABSL01063480.1 3221 .. 3355 (135 bp)     Patent sequences (3) AX780127.1 3271 .. 3405 (135 bp)   CQ850015.1 3978 .. 4112 (135 bp)   DL210638.1 3978 .. 4112 (135 bp)        Pan troglodytes Name: RH94274 Polymorphism info:   Cross References Gene GeneID: 453275   Symbol: NIPA2   Description: non imprinted in Prader-Willi/Angelman syndrome 2   Position:   Mapping Information RH94274 Sequence Map: Chr 15 Map Viewer   Position: 20581583-20581717 (bp) Electronic PCR results RefSeq mRNA (5 of 14)[Show All Hits] XM_001158930.1 3289 .. 3423 (135 bp)   XM_001158981.1 3229 .. 3363 (135 bp)   XM_001159024.1 3516 .. 3650 (135 bp)   XM_001159070.1 3371 .. 3505 (135 bp)   XM_510259.2 3513 .. 3647 (135 bp)     Genomic RefSeqs (1) NW_001225210.1 269506 .. 269640 (135 bp)     Whole Genome Shotgun sequences (2) AADA01290233.1 14420 .. 14554 (135 bp)   AACZ02153306.1 29425 .. 29559 (135 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement