PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:860 Links D17S2149 Homo sapiens chromosome 17, locus PTRH2 Pan troglodytes chromosome 17, locus LOC455170 Found by e-PCR in sequences from Homo sapiens, Pan troglodytes, Papio anubis and Pongo abelii. Primer Information Forward primer: AAACACTTGTGATGGAGGGG Reverse primer: ACGTACTCAGATTGCCCCAG PCR product size: 142 (bp), Homo sapiens GenBank Accession: G15271    Homo sapiens Name: D17S2149 Also known as: GDB:736800 SHGC-15925 Polymorphism info:   Cross References Gene GeneID: 51651   Symbol: PTRH2   Description: peptidyl-tRNA hydrolase 2   Position: 17q23.1 UniGene Hs.12677 Peptidyl-tRNA hydrolase 2 Mapping Information D17S2149 Sequence Map: Chr 17|HuRef Map Viewer   Position: 53147421-53147562 (bp)   D17S2149 Sequence Map: Chr 17|Celera Map Viewer   Position: 54238509-54238650 (bp)   D17S2149 Sequence Map: Chr 17 Map Viewer   Position: 57774758-57774899 (bp) Electronic PCR results RefSeq mRNA (1) NM_016077.3 566 .. 707 (142 bp)     mRNA (5 of 6)[Show All Hits] AF151905.1 568 .. 709 (142 bp)   AL137322.1 434 .. 575 (142 bp)   BC006807.1 479 .. 620 (142 bp)   AK057033.1 1817 .. 1958 (142 bp)   AK098219.1 1955 .. 2096 (142 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_926894.1 12169531 .. 12169672 (142 bp)   AC_000060.1 54238509 .. 54238650 (142 bp)   NW_001838449.1 123202 .. 123343 (142 bp)   AC_000149.1 53147421 .. 53147562 (142 bp)   NT_010783.15 23048910 .. 23049051 (142 bp)     Genomic (3) G15271.1 98 .. 239 (142 bp)   AC091271.8 18949 .. 19090 (142 bp)   AC040904.4 54989 .. 55130 (142 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC074102.2 55483 .. 55624 (142 bp)     ESTs (5 of 72)[Show All Hits] T65064.1 98 .. 239 (142 bp)   T88811.1 57 .. 198 (142 bp)   T88833.1 29 .. 170 (142 bp)   N94348.1 97 .. 238 (142 bp)   W69148.1 97 .. 238 (142 bp)     Whole Genome Shotgun sequences (5) AADD01155238.1 59869 .. 60010 (142 bp)   AADC01131271.1 4281 .. 4422 (142 bp)   AADB02018594.1 59857 .. 59998 (142 bp)   ABBA01003171.1 56926 .. 57067 (142 bp)   ABSL01067426.1 56926 .. 57067 (142 bp)     Patent sequences (5 of 7)[Show All Hits] BD063620.1 501 .. 642 (142 bp)   AX714588.1 1817 .. 1958 (142 bp)   CQ725311.1 566 .. 707 (142 bp)   CQ981331.1 568 .. 709 (142 bp)   BD286811.1 1817 .. 1958 (142 bp)     High Thoughput cDNA sequences (1) BC017457.1 1800 .. 1941 (142 bp)        Pan troglodytes Name: D17S2149 Polymorphism info:   Cross References Gene GeneID: 455170   Symbol: LOC455170   Description: hypothetical LOC455170   Position:   Mapping Information D17S2149 Sequence Map: Chr 17 Map Viewer   Position: 58900308-58900449 (bp) Electronic PCR results RefSeq mRNA (1) XR_022917.1 3892 .. 4033 (142 bp)     Genomic RefSeqs (1) NW_001226991.1 432959 .. 433100 (142 bp)     Whole Genome Shotgun sequences (2) AADA01066859.1 1685 .. 1826 (142 bp)   AACZ02172134.1 53578 .. 53719 (142 bp)        Papio anubis   Polymorphism info:   Electronic PCR results ESTs (2) FC114216.1 648 .. 789 (142 bp)   FC168169.1 64 .. 205 (142 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01152269.1 19703 .. 19844 (142 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement