PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:83649 Links RH92112 Homo sapiens chromosome 1, locus CAMSAP1L1 Macaca mulatta chromosome 1, locus LOC709092 Pan troglodytes chromosome 1, locus CAMSAP1L1 Found by e-PCR in sequences from Homo sapiens, Macaca mulatta, Pan troglodytes and Pongo abelii. Primer Information Forward primer: AAAATCTGCAGGCTTCCAGA Reverse primer: TTGCATGAAAATTAAATTTGGC PCR product size: 168 (bp), Homo sapiens    Homo sapiens Name: RH92112 Also known as: stSG46550 Polymorphism info:   Cross References Gene GeneID: 23271   Symbol: CAMSAP1L1   Description: calmodulin regulated spectrin-associated protein 1-like 1   Position: 1q32.1 UniGene Hs.23585 Calmodulin regulated spectrin-associated protein 1-like 1 Mapping Information RH92112 Sequence Map: Chr 1|HuRef Map Viewer   Position: 171993693-171993860 (bp)   RH92112 Sequence Map: Chr 1|Celera Map Viewer   Position: 173950634-173950801 (bp)   RH92112 Sequence Map: Chr 1 Map Viewer   Position: 200826563-200826730 (bp)   stSG46550 GeneMap99-GB4 Map: Chr 1 Map Viewer   Position: 665.63 (cR3000)   Lod score: 0.38   Reference Interval: D1S2622-D1S306 Electronic PCR results Genomic RefSeqs (5 of 6)[Show All Hits] NW_926128.1 39205393 .. 39205560 (168 bp)   AC_000044.1 173950634 .. 173950801 (168 bp)   AC_000133.1 171993693 .. 171993860 (168 bp)   NW_001838533.2 5111391 .. 5111558 (168 bp)   NT_004487.19 52315205 .. 52315372 (168 bp)     Genomic (2) AL450104.14 148599 .. 148766 (168 bp)   AC099756.2 39556 .. 39723 (168 bp)     Working Draft phase 1 (from GenBank HTGS division) (2) AC025349.2 161074 .. 161241 (168 bp)   AC027113.3 116505 .. 116672 (168 bp)     ESTs (2) AA406094.1 125 .. 292 (168 bp)   AI824531.1 128 .. 295 (168 bp)     Whole Genome Shotgun sequences (5) AADD01011703.1 2678 .. 2845 (168 bp)   AADC01009767.1 13206 .. 13373 (168 bp)   AADB02001065.1 210951 .. 211118 (168 bp)   ABBA01027542.1 24805 .. 24972 (168 bp)   ABSL01055473.1 24803 .. 24970 (168 bp)     Patent sequences (1) HA128186.1 125 .. 292 (168 bp)        Macaca mulatta Name: RH92112 Polymorphism info:   Cross References Gene GeneID: 709092   Symbol: LOC709092   Description: similar to calmodulin regulated spectrin-associated protein 1-like 1   Position:   Mapping Information RH92112 Sequence Map: Chr 1 Map Viewer   Position: 169636266-169636433 (bp) Electronic PCR results Genomic RefSeqs (1) NW_001109048.1 3397544 .. 3397711 (168 bp)     Whole Genome Shotgun sequences (1) AANU01241850.1 22132 .. 22299 (168 bp)        Pan troglodytes Name: RH92112 Polymorphism info:   Cross References Gene GeneID: 457611   Symbol: CAMSAP1L1   Description: calmodulin regulated spectrin-associated protein 1-like 1   Position:   Mapping Information RH92112 Sequence Map: Chr 1 Map Viewer   Position: 180850140-180850307 (bp) Electronic PCR results RefSeq mRNA (1) XM_001143767.1 4406 .. 4573 (168 bp)     Genomic RefSeqs (1) NW_001229611.1 4012339 .. 4012506 (168 bp)     Whole Genome Shotgun sequences (2) AADA01072568.1 3597 .. 3764 (168 bp)   AACZ02012051.1 9183 .. 9350 (168 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01386314.1 13092 .. 13259 (168 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement