PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:81139 Links WI-16389 Homo sapiens chromosome 15, locus AQR Pan troglodytes chromosome 15, locus AQR Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TTTACATAAAGACAGCAAACAAAGG Reverse primer: CTGGACTTAACCACGAATACCC PCR product size: 125 (bp), Homo sapiens GenBank Accession: G21792 H88465    Homo sapiens Name: WI-16389 Also known as: EST390774 Polymorphism info:   Cross References Gene GeneID: 9716   Symbol: AQR   Description: aquarius homolog (mouse)   Position: 15q14 UniGene Hs.510958 Aquarius homolog (mouse) Mapping Information WI-16389 Sequence Map: Chr 15|Celera Map Viewer   Position: 11907882-11908006 (bp)   WI-16389 Sequence Map: Chr 15|HuRef Map Viewer   Position: 11994148-11994272 (bp)   WI-16389 Sequence Map: Chr 15 Map Viewer   Position: 35148527-35148651 (bp)   WI-16389 Whitehead-RH Map: Chr 15 Map Viewer   Position: 49.9 (cR3000)   Lod score: P2.01   WI-16389 GeneMap99-GB4 Map: Chr 15 Map Viewer   Position: 89.45 (cR3000)   Lod score: 3.00   Reference Interval: D15S144-D15S118 Electronic PCR results mRNA (2) AK001173.1 736 .. 860 (125 bp)   AB011132.3 4909 .. 5033 (125 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_925840.1 2190651 .. 2190775 (125 bp)   AC_000058.1 11907882 .. 11908006 (125 bp)   AC_000147.1 11994148 .. 11994272 (125 bp)   NW_001838214.2 8724740 .. 8724864 (125 bp)   NT_010194.17 5939084 .. 5939208 (125 bp)     Genomic (2) G21792.1 3 .. 127 (125 bp)   AC018868.4 42716 .. 42840 (125 bp)     Working Draft phase 1 (from GenBank HTGS division) (3) AC069140.2 9454 .. 9578 (125 bp)   AC090783.2 4757 .. 4881 (125 bp)   AC091056.4 42665 .. 42789 (125 bp)     ESTs (1) H88465.1 3 .. 127 (125 bp)     Whole Genome Shotgun sequences (5) AADD01142190.1 781 .. 905 (125 bp)   AADC01119744.1 221594 .. 221718 (125 bp)   AADB02016381.1 279514 .. 279638 (125 bp)   ABBA01038517.1 950 .. 1074 (125 bp)   ABSL01062381.1 950 .. 1074 (125 bp)     Patent sequences (4) BD155980.1 736 .. 860 (125 bp)   AX876153.1 736 .. 860 (125 bp)   DD129440.1 5055 .. 5179 (125 bp)   DD414691.1 5055 .. 5179 (125 bp)     High Thoughput cDNA sequences (1) EF553519.1 4942 .. 5066 (125 bp)        Pan troglodytes Name: WI-16389 Polymorphism info:   Cross References Gene GeneID: 453308   Symbol: AQR   Description: aquarius homolog (mouse)   Position:   Mapping Information WI-16389 Sequence Map: Chr 15 Map Viewer   Position: 31714374-31714498 (bp) Electronic PCR results RefSeq mRNA (1) XM_510286.2 5170 .. 5294 (125 bp)     Genomic RefSeqs (1) NW_001225228.1 309948 .. 310072 (125 bp)     Whole Genome Shotgun sequences (2) AADA01112666.1 1325 .. 1449 (125 bp)   AACZ02153949.1 1594 .. 1718 (125 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement