PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:79854 Links RH66452 Primer Information Forward primer: TTGCATTCTCCAAATGTTTCCAG Reverse primer: AATTCCCAACAAAAAGTTGGGCAC PCR product size: 117 (bp), Homo sapiens    Homo sapiens Name: RH66452 Also known as: stSG35871 Polymorphism info:   Cross References UniGene Hs.503597 CWC15 homolog (S. cerevisiae) Mapping Information stSG35871 GeneMap99-GB4 Map: Chr 11 Map Viewer   Position: 320.55 (cR3000)   Lod score: 0.23   Reference Interval: D11S1311-D11S917 Electronic PCR results ESTs (1) H60169.1 113 .. 229 (117 bp)     Patent sequences (5) CQ481522.1 187 .. 302 (116 bp)   CQ490865.1 1024 .. 1139 (116 bp)   CQ496713.1 1024 .. 1139 (116 bp)   CQ502667.1 229 .. 344 (116 bp)   CQ511526.1 229 .. 344 (116 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement