PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:67640 Links HSC15C102 Homo sapiens chromosome 15, loci NIPA2 and CYFIP1 Macaca mulatta chromosome 7, locus LOC710147 Pan troglodytes chromosome 15, locus NIPA2 Found by e-PCR in sequences from Homo sapiens, Macaca mulatta, Pan troglodytes and Pongo abelii. Primer Information Forward primer: TCTACCTTTTCTGCATATGTTTGC Reverse primer: AGCTCTGGGAAATAGAAGACTAGG PCR product size: 251 (bp), Homo sapiens GenBank Accession: G11828 Z39245    Homo sapiens Name: HSC15C102 Also known as: WI-9653 Polymorphism info:   Cross References Gene GeneID: 23191   Symbol: CYFIP1   Description: cytoplasmic FMR1 interacting protein 1   Position: 15q11 Gene GeneID: 81614   Symbol: NIPA2   Description: non imprinted in Prader-Willi/Angelman syndrome 2   Position: 15q11.2 UniGene Hs.26704 Cytoplasmic FMR1 interacting protein 1   Hs.591003 Non imprinted in Prader-Willi/Angelman syndrome 2 Mapping Information HSC15C102 Sequence Map: Chr 15|HuRef Map Viewer   Position: 1317550-1317800 (bp)   HSC15C102 Sequence Map: Chr 15|Celera Map Viewer   Position: 1374395-1374645 (bp)   HSC15C102 Sequence Map: Chr 15 Map Viewer   Position: 23005167-23005417 (bp) Electronic PCR results mRNA (2) AK127094.1 4894 .. 5149 (256 bp)   AY763579.1 4894 .. 5149 (256 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_925761.1 92849 .. 93099 (251 bp)   AC_000058.1 1374395 .. 1374645 (251 bp)   AC_000147.1 1317550 .. 1317800 (251 bp)   NW_001838191.2 317647 .. 317897 (251 bp)   NT_078094.2 358974 .. 359224 (251 bp)     Genomic (3) G11828.1 27 .. 277 (251 bp)   AC016204.12 32978 .. 33228 (251 bp)   AC011767.12 31944 .. 32194 (251 bp)     ESTs (5 of 14)[Show All Hits] Z39245.1 27 .. 277 (251 bp)   R56244.1 39 .. 289 (251 bp)   AI085918.1 32 .. 287 (256 bp)   AI491861.1 27 .. 282 (256 bp)   AI590819.1 54 .. 309 (256 bp)     Whole Genome Shotgun sequences (5) AADD01141596.1 2467 .. 2722 (256 bp)   AADC01118922.1 8555 .. 8810 (256 bp)   AADB02016226.1 13098 .. 13348 (251 bp)   ABBA01040251.1 2183 .. 2433 (251 bp)   ABSL01063480.1 2184 .. 2439 (256 bp)     Patent sequences (4) AX780127.1 2234 .. 2489 (256 bp)   CQ850015.1 4894 .. 5149 (256 bp)   CQ855169.1 2153 .. 2403 (251 bp)   DL210638.1 4894 .. 5149 (256 bp)        Macaca mulatta Name: HSC15C102 Polymorphism info:   Cross References Gene GeneID: 710147   Symbol: LOC710147   Description: similar to non imprinted in Prader-Willi/Angelman syndrome 2 isoform a   Position:   UniGene Mmu.13329 Similar to non imprinted in Prader-Willi/Angelman syndrome 2 isoform a Mapping Information HSC15C102 Sequence Map: Chr 7 Map Viewer   Position: 1784301-1784543 (bp) Electronic PCR results RefSeq mRNA (5) XM_001106072.1 2467 .. 2709 (243 bp)   XM_001106137.1 2373 .. 2615 (243 bp)   XM_001106204.1 2488 .. 2730 (243 bp)   XM_001106265.1 2233 .. 2475 (243 bp)   XM_001105995.1 2161 .. 2403 (243 bp)     Genomic RefSeqs (1) NW_001121136.1 237762 .. 238004 (243 bp)     Whole Genome Shotgun sequences (1) AANU01129034.1 7805 .. 8047 (243 bp)        Pan troglodytes Name: HSC15C102 Polymorphism info:   Cross References Gene GeneID: 453275   Symbol: NIPA2   Description: non imprinted in Prader-Willi/Angelman syndrome 2   Position:   Mapping Information HSC15C102 Sequence Map: Chr 15 Map Viewer   Position: 20582499-20582751 (bp) Electronic PCR results RefSeq mRNA (5 of 14)[Show All Hits] XM_001158930.1 2255 .. 2507 (253 bp)   XM_001158981.1 2195 .. 2447 (253 bp)   XM_001159024.1 2482 .. 2734 (253 bp)   XM_001159070.1 2337 .. 2589 (253 bp)   XM_510259.2 2479 .. 2731 (253 bp)     Genomic RefSeqs (1) NW_001225210.1 270422 .. 270674 (253 bp)     Whole Genome Shotgun sequences (2) AADA01290233.1 15336 .. 15588 (253 bp)   AACZ02153306.1 30341 .. 30593 (253 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01080819.1 10297 .. 10557 (261 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement