PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:66024 Links RH36621 Homo sapiens chromosome 11, locus TCP11L1 Pan troglodytes chromosome 11 Found by e-PCR in sequences from Homo sapiens, Pan troglodytes and Pongo abelii. Primer Information Forward primer: TCCAGACATTTCTCTTCGTTCA Reverse primer: CCCCCAAAGATACAGTTATTGG PCR product size: 194 (bp), Homo sapiens    Homo sapiens Name: RH36621 Also known as: stSG15791 Polymorphism info:   Cross References Gene GeneID: 55346   Symbol: TCP11L1   Description: t-complex 11 (mouse)-like 1   Position: 11p13 UniGene Hs.655341 T-complex 11 (mouse)-like 1 Mapping Information RH36621 Sequence Map: Chr 11|HuRef Map Viewer   Position: 32789520-32789713 (bp)   RH36621 Sequence Map: Chr 11 Map Viewer   Position: 33094847-33095040 (bp)   RH36621 Sequence Map: Chr 11|Celera Map Viewer   Position: 33241547-33241740 (bp)   stSG15791 NCBI RH Map: Chr 11 Map Viewer   Position: 235.4 (cR)   Lod score: 1.71   stSG15791 GeneMap99-GB4 Map: Chr 11 Map Viewer   Position: 125.99 (cR3000)   Lod score: 1.09   Reference Interval: D11S914-D11S907 Electronic PCR results RefSeq mRNA (2) NM_001145541.1 2371 .. 2564 (194 bp)   NM_018393.3 2555 .. 2748 (194 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_925006.1 28741871 .. 28742064 (194 bp)   AC_000054.1 33241547 .. 33241740 (194 bp)   AC_000143.1 32789520 .. 32789713 (194 bp)   NW_001838022.2 17826329 .. 17826522 (194 bp)   NT_009237.18 33034847 .. 33035040 (194 bp)     Genomic (2) AL121926.24 69479 .. 69672 (194 bp)   AC131263.6 134469 .. 134662 (194 bp)     ESTs (5 of 10)[Show All Hits] R81557.1 10 .. 203 (194 bp)   W81576.1 50 .. 243 (194 bp)   AI074804.1 68 .. 261 (194 bp)   AI627556.1 32 .. 225 (194 bp)   AI769289.1 80 .. 273 (194 bp)     Whole Genome Shotgun sequences (5) AADD01114363.1 1503 .. 1696 (194 bp)   AADC01097258.1 527216 .. 527409 (194 bp)   AADB02013801.1 574856 .. 575049 (194 bp)   ABBA01060898.1 145586 .. 145779 (194 bp)   ABSL01074064.1 145587 .. 145780 (194 bp)     Patent sequences (2) AX331722.1 50 .. 243 (194 bp)   DL063118.1 50 .. 243 (194 bp)        Pan troglodytes Name: RH36621 Polymorphism info:   Mapping Information RH36621 Sequence Map: Chr 11 Map Viewer   Position: 33309020-33309213 (bp) Electronic PCR results Genomic RefSeqs (1) NW_001222276.1 2876688 .. 2876881 (194 bp)     Whole Genome Shotgun sequences (2) AADA01359733.1 49820 .. 50013 (194 bp)   AACZ02123700.1 134249 .. 134442 (194 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01362631.1 6929 .. 7117 (189 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement