PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:65473 Links G30318 Homo sapiens chromosome 6, locus VTA1 Pan troglodytes chromosome 6, locus VTA1 Found by e-PCR in sequences from Homo sapiens, Pan troglodytes and Pongo abelii. Primer Information Forward primer: TCATCTGTTTGTCCAAACATTACA Reverse primer: TGAAAACACACCTCTATAAAATGTG PCR product size: 100 (bp), Homo sapiens GenBank Accession: G30318    Homo sapiens Name: G30318 Also known as: SHGC-36759 Polymorphism info:   Cross References Gene GeneID: 51534   Symbol: VTA1   Description: Vps20-associated 1 homolog (S. cerevisiae)   Position: 6q24.1 UniGene Hs.431367 Vps20-associated 1 homolog (S. cerevisiae)   Hs.595041 Transcribed locus Mapping Information G30318 Sequence Map: Chr 6|HuRef Map Viewer   Position: 140106066-140106165 (bp)   G30318 Sequence Map: Chr 6 Map Viewer   Position: 142540051-142540150 (bp)   G30318 Sequence Map: Chr 6|Celera Map Viewer   Position: 143280530-143280629 (bp) Electronic PCR results RefSeq mRNA (1) NM_016485.3 1210 .. 1309 (100 bp)     mRNA (5 of 10)[Show All Hits] AK000051.1 1210 .. 1310 (101 bp)   AF271994.1 1210 .. 1309 (100 bp)   AY007093.1 1025 .. 1124 (100 bp)   AF060225.1 1211 .. 1310 (100 bp)   BC005937.1 1116 .. 1215 (100 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_923184.1 75349134 .. 75349233 (100 bp)   AC_000049.1 143280530 .. 143280629 (100 bp)   AC_000138.1 140106066 .. 140106165 (100 bp)   NW_001838990.2 15016733 .. 15016832 (100 bp)   NT_025741.15 46709508 .. 46709607 (100 bp)     Genomic (2) G30318.1 73 .. 172 (100 bp)   AL033522.1 109728 .. 109827 (100 bp)     Working Draft phase 1 (from GenBank HTGS division) (2) AL355489.6 104013 .. 104112 (100 bp)   AC090439.8 26134 .. 26233 (100 bp)     ESTs (5 of 64)[Show All Hits] Z41629.1 59 .. 158 (100 bp)   T35829.1 31 .. 130 (100 bp)   T35868.1 31 .. 130 (100 bp)   T35882.1 31 .. 130 (100 bp)   R38412.1 73 .. 172 (100 bp)     Whole Genome Shotgun sequences (5 of 6)[Show All Hits] AADD01075698.1 1332 .. 1431 (100 bp)   AADC01064570.1 110459 .. 110558 (100 bp)   AADB02190282.1 449 .. 548 (100 bp)   AADB02010193.1 1930813 .. 1930912 (100 bp)   ABBA01025757.1 586051 .. 586150 (100 bp)     Patent sequences (1) DD388104.1 934 .. 1033 (100 bp)     High Thoughput cDNA sequences (4) AF151062.1 1218 .. 1317 (100 bp)   AL136684.1 1214 .. 1313 (100 bp)   BC013217.1 714 .. 813 (100 bp)   CR606694.1 1278 .. 1377 (100 bp)        Pan troglodytes Name: G30318 Polymorphism info:   Cross References Gene GeneID: 463033   Symbol: VTA1   Description: Vps20-associated 1 homolog (S. cerevisiae)   Position:   Mapping Information G30318 Sequence Map: Chr 6 Map Viewer   Position: 144695092-144695191 (bp) Electronic PCR results RefSeq mRNA (3) XM_518771.2 1401 .. 1500 (100 bp)   XM_001172031.1 1404 .. 1503 (100 bp)   XM_001172055.1 1320 .. 1419 (100 bp)     Genomic RefSeqs (1) NW_001236564.1 36902711 .. 36902810 (100 bp)     Whole Genome Shotgun sequences (2) AADA01069970.1 4832 .. 4931 (100 bp)   AACZ02076274.1 4997 .. 5096 (100 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results RefSeq mRNA (1) NM_001133194.1 1245 .. 1344 (100 bp)     Whole Genome Shotgun sequences (1) ABGA01221140.1 5643 .. 5741 (99 bp)     High Thoughput cDNA sequences (1) CR860737.1 1245 .. 1344 (100 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement