PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:65110 Links RH44489 Homo sapiens chromosome 12, locus ANKLE2 Pan troglodytes chromosome 12, loci LOC452390 and PGAM5 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TCAGGGCCAAAACGTTTTAC Reverse primer: ACATGCTATTCTAAAAAGCCGC PCR product size: 160 (bp), Homo sapiens    Homo sapiens Name: RH44489 Also known as: stSG4731 Polymorphism info:   Cross References Gene GeneID: 23141   Symbol: ANKLE2   Description: ankyrin repeat and LEM domain containing 2   Position: 12q24.33 UniGene Hs.654628 Ankyrin repeat and LEM domain containing 2   Hs.666964 Transcribed locus Mapping Information RH44489 Sequence Map: Chr 12|HuRef Map Viewer   Position: 130081523-130081682 (bp)   RH44489 Sequence Map: Chr 12|Celera Map Viewer   Position: 133002795-133002954 (bp)   RH44489 Sequence Map: Chr 12 Map Viewer   Position: 133302254-133302413 (bp)   stSG4731 GeneMap99-GB4 Map: Chr 12 Map Viewer   Position: 504.68 (cR3000)   Lod score: 0.69   Reference Interval: D12S97-qTEL Electronic PCR results RefSeq mRNA (1) NM_015114.1 4299 .. 4458 (160 bp)     mRNA (4) AB014592.1 3768 .. 3927 (160 bp)   AK025933.1 2017 .. 2176 (160 bp)   BC062373.1 2330 .. 2489 (160 bp)   BC082962.1 2330 .. 2489 (160 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_925428.1 454899 .. 455058 (160 bp)   AC_000055.1 133002795 .. 133002954 (160 bp)   AC_000144.1 130081523 .. 130081682 (160 bp)   NW_001838067.2 16994 .. 17153 (160 bp)   NT_024477.14 495262 .. 495421 (160 bp)     Genomic (2) AC135586.8 23125 .. 23284 (160 bp)   BV180587.1 4065 .. 4224 (160 bp)     ESTs (5 of 38)[Show All Hits] T89639.1 21 .. 180 (160 bp)   T89733.1 19 .. 178 (160 bp)   R43106.1 20 .. 179 (160 bp)   R59085.1 19 .. 178 (160 bp)   N94582.1 5 .. 164 (160 bp)     Whole Genome Shotgun sequences (5) AADD01129574.1 2629 .. 2788 (160 bp)   AADC01111222.1 1814 .. 1973 (160 bp)   AADB02015899.1 2629 .. 2788 (160 bp)   ABBA01012372.1 3536 .. 3695 (160 bp)   ABSL01043710.1 3536 .. 3695 (160 bp)     Patent sequences (4) BD072970.1 1144 .. 1303 (160 bp)   AX777327.1 3768 .. 3927 (160 bp)   CQ920626.1 235 .. 394 (160 bp)   CS382236.1 3768 .. 3927 (160 bp)        Pan troglodytes Name: RH44489 Polymorphism info:   Cross References Gene GeneID: 452388   Symbol: PGAM5   Description: phosphoglycerate mutase family member 5   Position:   Gene GeneID: 452390   Symbol: LOC452390   Description: similar to KIAA0692 protein   Position:   Mapping Information RH44489 Sequence Map: Chr 12 Map Viewer   Position: 134852828-134852987 (bp) Electronic PCR results RefSeq mRNA (1) XM_509500.2 4145 .. 4304 (160 bp)     Genomic RefSeqs (1) NW_001223211.1 67006 .. 67165 (160 bp)     Whole Genome Shotgun sequences (2) AADA01233313.1 2997 .. 3156 (160 bp)   AACZ02140037.1 4055 .. 4214 (160 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement