ncbi logo		 UniSTS logo
 PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure
  Search for

Entrez UniSTS
Help
Query tips
Submit
Submit map
FTP site
Statistics

Related sites
e-PCR
Map Viewer
Gene
UniGene
dbSNP
GeneMap'99
MGD
ZFIN

Genomic biology
Bos taurus
Canis familiaris
Danio rerio
Homo sapiens
Mus musculus
Rattus novegicus
Sus scrofa

UniSTS:63735 Links
NIB1540
Homo sapiens chromosome 15, loci NIPA2 and CYFIP1
Pan troglodytes chromosome 15, locus NIPA2

Found by e-PCR in sequences from Homo sapiens, Pan troglodytes, Papio anubis and Pongo abelii.

Primer InformationHelp

Forward primer:TATTTCCCAGAGCTGTTCAA
Reverse primer:ACATCCTGCCTGCTGTTG
PCR product size:163 (bp), Homo sapiens
GenBank Accession:T16604

   Homo sapiens
Name: NIB1540
Also known as: STS-T16604 sts-T16604
Polymorphism info:  

Cross References Help
Gene GeneID:23191
 Symbol:CYFIP1
 Description:cytoplasmic FMR1 interacting protein 1
 Position:15q11
Gene GeneID:81614
 Symbol:NIPA2
 Description:non imprinted in Prader-Willi/Angelman syndrome 2
 Position:15q11.2
UniGeneHs.26704 Cytoplasmic FMR1 interacting protein 1
 Hs.591003 Non imprinted in Prader-Willi/Angelman syndrome 2

Mapping InformationHelp
NIB1540 Sequence Map: Chr 15|HuRef Map Viewer
  Position: 1317787-1317950 (bp)
 
NIB1540 Sequence Map: Chr 15|Celera Map Viewer
  Position: 1374245-1374408 (bp)
 
NIB1540 Sequence Map: Chr 15 Map Viewer
  Position: 23005404-23005567 (bp)
 
NIB1540 NCBI RH Map: Chr 15 Map Viewer
  Position: 10 (cR)
  Lod score: 1.45
 
NIB1540 Whitehead-RH Map: Chr 15 Map Viewer
  Position: 0.0 (cR3000)
  Lod score: F
 
NIB1540 GeneMap99-GB4 Map: Chr 15 Map Viewer
  Position: 22.56 (cR3000)
  Lod score: 1.53
  Reference Interval: pTEL-D15S122
 
sts-T16604 GeneMap99-GB4 Map: Chr 15 Map Viewer
  Position: 22.56 (cR3000)
  Lod score: 1.53
  Reference Interval: pTEL-D15S122

Electronic PCR results Help
RefSeq mRNA (4)
NM_001008860.1 2228 .. 2391 (164 bp)  
NM_030922.5 2350 .. 2513 (164 bp)  
NM_001008894.1 2035 .. 2198 (164 bp)  
NM_001008892.1 2092 .. 2255 (164 bp)  
 
mRNA (5 of 8)[Show All Hits]
U90904.1 1203 .. 1366 (164 bp)  
AK096305.1 2125 .. 2288 (164 bp)  
BC011775.2 2023 .. 2186 (164 bp)  
AK127094.1 5136 .. 5299 (164 bp)  
BC000957.3 1541 .. 1704 (164 bp)  
 
Genomic RefSeqs (5 of 6)[Show All Hits]
NW_925761.1 92699 .. 92862 (164 bp)  
AC_000058.1 1374245 .. 1374408 (164 bp)  
AC_000147.1 1317787 .. 1317950 (164 bp)  
NW_001838191.2 317497 .. 317660 (164 bp)  
NT_078094.2 359211 .. 359374 (164 bp)  
 
Genomic (2)
AC016204.12 33215 .. 33378 (164 bp)  
AC011767.12 32181 .. 32344 (164 bp)  
 
ESTs (5 of 117)[Show All Hits]
T16604.1 56 .. 219 (164 bp)  
T66278.1 143 .. 306 (164 bp)  
R38195.1 71 .. 234 (164 bp)  
R44910.1 66 .. 231 (166 bp)  
R61323.1 65 .. 228 (164 bp)  
 
Whole Genome Shotgun sequences (5)
AADD01141596.1 2317 .. 2480 (164 bp)  
AADC01118922.1 8797 .. 8960 (164 bp)  
AADB02016226.1 12948 .. 13111 (164 bp)  
ABBA01040251.1 2033 .. 2196 (164 bp)  
ABSL01063480.1 2034 .. 2197 (164 bp)  
 
Patent sequences (5 of 24)[Show All Hits]
AX410811.1 1203 .. 1366 (164 bp)  
AX454746.1 1339 .. 1502 (164 bp)  
AX491224.1 1339 .. 1502 (164 bp)  
AX780127.1 2084 .. 2247 (164 bp)  
CQ850015.1 5136 .. 5299 (164 bp)  
 
High Thoughput cDNA sequences (2)
CR606982.1 2065 .. 2228 (164 bp)  
CR625512.1 1235 .. 1398 (164 bp)  
 

   Pan troglodytes
Name: NIB1540
Polymorphism info:  

Cross References Help
Gene GeneID:453275
 Symbol:NIPA2
 Description:non imprinted in Prader-Willi/Angelman syndrome 2
 Position: 

Mapping InformationHelp
NIB1540 Sequence Map: Chr 15 Map Viewer
  Position: 20582738-20582905 (bp)

Electronic PCR results Help
RefSeq mRNA (5 of 14)[Show All Hits]
XM_001158930.1 2101 .. 2268 (168 bp)  
XM_001158981.1 2041 .. 2208 (168 bp)  
XM_001159024.1 2328 .. 2495 (168 bp)  
XM_001159070.1 2183 .. 2350 (168 bp)  
XM_510259.2 2325 .. 2492 (168 bp)  
 
Genomic RefSeqs (1)
NW_001225210.1 270661 .. 270828 (168 bp)  
 
Whole Genome Shotgun sequences (2)
AADA01290233.1 15575 .. 15742 (168 bp)  
AACZ02153306.1 30580 .. 30747 (168 bp)  
 

   Papio anubis
 
Polymorphism info:  

Electronic PCR results Help
ESTs (5 of 10)[Show All Hits]
FC111864.1 24 .. 187 (164 bp)  
FC117836.1 31 .. 194 (164 bp)  
FC149837.1 471 .. 634 (164 bp)  
FC147798.1 23 .. 186 (164 bp)  
FC148775.1 13 .. 176 (164 bp)  
 

   Pongo abelii
 
Polymorphism info:  

Electronic PCR results Help
Whole Genome Shotgun sequences (1)
ABGA01080819.1 10147 .. 10310 (164 bp)  
 

 

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement