PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:63684 Links WI-13811 Homo sapiens chromosome 11, locus CWC15 Pan troglodytes chromosome 11, locus CWC15 Found by e-PCR in sequences from Homo sapiens, Pan troglodytes and Pongo abelii. Primer Information Forward primer: TATTGTTTGAAGCTTTCTCAGGC Reverse primer: CTTGTGTTCTGGATACTCAACTGC PCR product size: 100 (bp), Homo sapiens GenBank Accession: G24342 R44122    Homo sapiens Name: WI-13811 Also known as: EST229004 Polymorphism info:   Cross References Gene GeneID: 51503   Symbol: CWC15   Description: CWC15 spliceosome-associated protein homolog (S. cerevisiae)   Position: 11q21 UniGene Hs.503597 CWC15 homolog (S. cerevisiae) Mapping Information WI-13811 Sequence Map: Chr 11|HuRef Map Viewer   Position: 90760741-90760840 (bp)   WI-13811 Sequence Map: Chr 11|Celera Map Viewer   Position: 91983595-91983694 (bp)   WI-13811 Sequence Map: Chr 11 Map Viewer   Position: 94695812-94695911 (bp)   WI-13811 NCBI RH Map: Chr 11 Map Viewer   Position: 794.1 (cR)   Lod score: 1.35   WI-13811 Whitehead-RH Map: Chr 11 Map Viewer   Position: 416.2 (cR3000)   Lod score: P0.01   WI-13811 GeneMap99-GB4 Map: Chr 11 Map Viewer   Position: 319.17 (cR3000)   Lod score: 3.00   Reference Interval: D11S1311-D11S917 Electronic PCR results RefSeq mRNA (1) NM_016403.3 1452 .. 1551 (100 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_925173.1 4852495 .. 4852594 (100 bp)   AC_000054.1 91983595 .. 91983694 (100 bp)   AC_000143.1 90760741 .. 90760840 (100 bp)   NW_001838042.2 25926169 .. 25926268 (100 bp)   NT_167190.1 40001607 .. 40001706 (100 bp)     Genomic (2) G24342.1 34 .. 133 (100 bp)   AP002383.3 85619 .. 85718 (100 bp)     Working Draft phase 1 (from GenBank HTGS division) (2) AC032024.3 61870 .. 61969 (100 bp)   AC023756.3 105232 .. 105331 (100 bp)     ESTs (5) R44122.1 34 .. 133 (100 bp)   AW273392.1 29 .. 128 (100 bp)   AW468672.1 29 .. 128 (100 bp)   CA413488.1 42 .. 141 (100 bp)   CN291030.1 15 .. 114 (100 bp)     Whole Genome Shotgun sequences (5) AADD01118303.1 18306 .. 18405 (100 bp)   AADC01101210.1 281121 .. 281220 (100 bp)   AADB02014322.1 1013027 .. 1013126 (100 bp)   ABBA01040022.1 54293 .. 54392 (100 bp)   ABSL01063342.1 54294 .. 54393 (100 bp)     Patent sequences (3) CQ490865.1 1479 .. 1578 (100 bp)   CQ496713.1 1479 .. 1578 (100 bp)   DD407968.1 34 .. 133 (100 bp)        Pan troglodytes Name: WI-13811 Polymorphism info:   Cross References Gene GeneID: 451493   Symbol: CWC15   Description: CWC15 spliceosome-associated protein homolog (S. cerevisiae)   Position:   Mapping Information WI-13811 Sequence Map: Chr 11 Map Viewer   Position: 93493501-93493600 (bp) Electronic PCR results RefSeq mRNA (3) XM_001144067.1 1605 .. 1704 (100 bp)   XM_508705.2 1422 .. 1521 (100 bp)   XM_001144223.1 1450 .. 1549 (100 bp)     Genomic RefSeqs (1) NW_001222310.1 4936577 .. 4936676 (100 bp)     Whole Genome Shotgun sequences (2) AADA01074871.1 19632 .. 19731 (100 bp)   AACZ02127356.1 19802 .. 19901 (100 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01170348.1 5029 .. 5129 (101 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement