PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:62060 Links G20583 Homo sapiens chromosome 12, locus ANKLE2 Pan troglodytes chromosome 12, locus LOC452390 Found by e-PCR in sequences from Homo sapiens, Pan troglodytes and Pongo abelii. Primer Information Forward primer: TAGAGAAAACAGATCATCACTAC Reverse primer: TTCATATGACAAGAGATAGGTC PCR product size: 221 (bp), Homo sapiens GenBank Accession: G20583    Homo sapiens Name: G20583 Also known as: A005X42 Polymorphism info:   Cross References Gene GeneID: 23141   Symbol: ANKLE2   Description: ankyrin repeat and LEM domain containing 2   Position: 12q24.33 UniGene Hs.654628 Ankyrin repeat and LEM domain containing 2   Hs.666964 Transcribed locus Mapping Information G20583 Sequence Map: Chr 12|HuRef Map Viewer   Position: 130081589-130081809 (bp)   G20583 Sequence Map: Chr 12|Celera Map Viewer   Position: 133002861-133003081 (bp)   G20583 Sequence Map: Chr 12 Map Viewer   Position: 133302320-133302540 (bp) Electronic PCR results RefSeq mRNA (1) NM_015114.1 4172 .. 4392 (221 bp)     mRNA (5) AB014592.1 3641 .. 3861 (221 bp)   AK024061.1 2883 .. 3103 (221 bp)   AK025933.1 1890 .. 2110 (221 bp)   BC062373.1 2203 .. 2423 (221 bp)   BC082962.1 2203 .. 2423 (221 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_925428.1 454965 .. 455185 (221 bp)   AC_000055.1 133002861 .. 133003081 (221 bp)   AC_000144.1 130081589 .. 130081809 (221 bp)   NW_001838067.2 16867 .. 17087 (221 bp)   NT_024477.14 495328 .. 495548 (221 bp)     Genomic (3) G20583.1 1 .. 221 (221 bp)   AC135586.8 22998 .. 23218 (221 bp)   BV180587.1 3938 .. 4158 (221 bp)     ESTs (5 of 54)[Show All Hits] T89733.1 85 .. 305 (221 bp)   T89831.1 39 .. 261 (223 bp)   R50099.1 66 .. 286 (221 bp)   R43106.1 86 .. 307 (222 bp)   R59085.1 85 .. 305 (221 bp)     Whole Genome Shotgun sequences (5) AADD01129574.1 2695 .. 2915 (221 bp)   AADC01111222.1 1687 .. 1907 (221 bp)   AADB02015899.1 2695 .. 2915 (221 bp)   ABBA01012372.1 3409 .. 3629 (221 bp)   ABSL01043710.1 3409 .. 3629 (221 bp)     Patent sequences (5 of 14)[Show All Hits] AX048080.1 3919 .. 4139 (221 bp)   AX053661.1 65 .. 285 (221 bp)   BD072970.1 1017 .. 1237 (221 bp)   BD155605.1 66 .. 286 (221 bp)   BD160330.1 2883 .. 3103 (221 bp)        Pan troglodytes Name: G20583 Polymorphism info:   Cross References Gene GeneID: 452390   Symbol: LOC452390   Description: similar to KIAA0692 protein   Position:   Mapping Information G20583 Sequence Map: Chr 12 Map Viewer   Position: 134852894-134853114 (bp) Electronic PCR results RefSeq mRNA (1) XM_509500.2 4018 .. 4238 (221 bp)     Genomic RefSeqs (1) NW_001223211.1 67072 .. 67292 (221 bp)     Whole Genome Shotgun sequences (2) AADA01233313.1 3063 .. 3283 (221 bp)   AACZ02140037.1 4121 .. 4341 (221 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01249779.1 3063 .. 3286 (224 bp)     High Thoughput cDNA sequences (1) CR858180.1 3914 .. 4137 (224 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement