PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:61422 Links SHGC-76118 Homo sapiens chromosome 1, locus CAMSAP1L1 Macaca mulatta chromosome 1, locus LOC709092 Pan troglodytes chromosome 1, locus CAMSAP1L1 Found by e-PCR in sequences from Homo sapiens, Macaca fascicularis, Macaca mulatta, Pan troglodytes and Pongo abelii. Primer Information Forward primer: TACATCAGCCTTTTCAGGGG Reverse primer: GACTTTGGAACAGCGTGGAC PCR product size: 242 (bp), Homo sapiens GenBank Accession: N20210    Homo sapiens Name: SHGC-76118 Also known as: N20210 Polymorphism info:   Cross References Gene GeneID: 23271   Symbol: CAMSAP1L1   Description: calmodulin regulated spectrin-associated protein 1-like 1   Position: 1q32.1 UniGene Hs.23585 Calmodulin regulated spectrin-associated protein 1-like 1 Mapping Information SHGC-76118 Sequence Map: Chr 1|HuRef Map Viewer   Position: 171986181-171986421 (bp)   SHGC-76118 Sequence Map: Chr 1|Celera Map Viewer   Position: 173943112-173943352 (bp)   SHGC-76118 Sequence Map: Chr 1 Map Viewer   Position: 200819041-200819281 (bp)   N20210 GeneMap99-GB4 Map: Chr 1 Map Viewer   Position: 665.18 (cR3000)   Lod score: 1.09   Reference Interval: D1S2622-D1S306 Electronic PCR results RefSeq mRNA (1) NM_203459.1 3414 .. 3654 (241 bp)     mRNA (5 of 6)[Show All Hits] AF087998.1 69 .. 309 (241 bp)   AB029001.2 2805 .. 3045 (241 bp)   BC056910.1 1958 .. 2198 (241 bp)   BC065508.1 1765 .. 2005 (241 bp)   BC125230.1 3145 .. 3385 (241 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_926128.1 39197871 .. 39198111 (241 bp)   AC_000044.1 173943112 .. 173943352 (241 bp)   AC_000133.1 171986181 .. 171986421 (241 bp)   NW_001838533.2 5118830 .. 5119070 (241 bp)   NT_004487.19 52307683 .. 52307923 (241 bp)     Genomic (3) AL450104.14 141077 .. 141317 (241 bp)   AC099756.2 32034 .. 32274 (241 bp)   DQ038309.1 2733 .. 2973 (241 bp)     Working Draft phase 1 (from GenBank HTGS division) (2) AC025349.2 73819 .. 74059 (241 bp)   AC027113.3 42652 .. 42892 (241 bp)     ESTs (5 of 14)[Show All Hits] N20210.1 144 .. 385 (242 bp)   N29278.1 38 .. 278 (241 bp)   AA909582.1 53 .. 293 (241 bp)   AI760316.1 55 .. 295 (241 bp)   AW237070.1 56 .. 296 (241 bp)     Whole Genome Shotgun sequences (5) AADD01011702.1 5568 .. 5808 (241 bp)   AADC01009767.1 5684 .. 5924 (241 bp)   AADB02001065.1 218400 .. 218640 (241 bp)   ABBA01027542.1 32244 .. 32484 (241 bp)   ABSL01055473.1 32252 .. 32492 (241 bp)     Patent sequences (2) CQ714511.1 1882 .. 2122 (241 bp)   BD457114.1 1290 .. 1530 (241 bp)        Macaca fascicularis   Polymorphism info:   Cross References UniGene Mfa.12912 Brain cDNA clone: QccE-16863, similar to human KIAA1078 protein (KIAA1078), ... Electronic PCR results mRNA (1) AB171437.1 1787 .. 2027 (241 bp)        Macaca mulatta Name: SHGC-76118 Polymorphism info:   Cross References Gene GeneID: 709092   Symbol: LOC709092   Description: similar to calmodulin regulated spectrin-associated protein 1-like 1   Position:   UniGene Mmu.13923 Similar to calmodulin regulated spectrin-associated protein 1-like 1 Mapping Information SHGC-76118 Sequence Map: Chr 1 Map Viewer   Position: 169643718-169643958 (bp) Electronic PCR results RefSeq mRNA (1) XM_001109492.1 3401 .. 3641 (241 bp)     Genomic RefSeqs (1) NW_001109048.1 3404996 .. 3405236 (241 bp)     Whole Genome Shotgun sequences (1) AANU01241850.1 29584 .. 29824 (241 bp)        Pan troglodytes Name: SHGC-76118 Polymorphism info:   Cross References Gene GeneID: 457611   Symbol: CAMSAP1L1   Description: calmodulin regulated spectrin-associated protein 1-like 1   Position:   Mapping Information SHGC-76118 Sequence Map: Chr 1 Map Viewer   Position: 180842617-180842857 (bp) Electronic PCR results RefSeq mRNA (5 of 7)[Show All Hits] XM_001144062.1 3441 .. 3681 (241 bp)   XM_514085.2 3408 .. 3648 (241 bp)   XM_001143924.1 3360 .. 3600 (241 bp)   XM_001143855.1 3408 .. 3648 (241 bp)   XM_001143767.1 3408 .. 3648 (241 bp)     Genomic RefSeqs (1) NW_001229611.1 4004816 .. 4005056 (241 bp)     Whole Genome Shotgun sequences (2) AADA01072568.1 11043 .. 11283 (241 bp)   AACZ02012051.1 16633 .. 16873 (241 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01386314.1 5532 .. 5772 (241 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement